EMAIL THIS PAGE TO A FRIEND

PSMC1

proteasome (prosome, macropain) 26S subunit, ATPase, 1

52 Gene Product Result for
Synonyms: P26S4 S4 p56
UniProtKB ID: P62191, P49014, Q03527, Q6IAW0, Q96AZ3
Gene ID:
Human(5700) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
Mouse(19179) protease (prosome, macropain) 26S subunit, ATPase 1
Rat(117263) proteasome (prosome, macropain) 26S subunit, ATPase, 1
chicken(395804) proteasome (prosome, macropain) 26S subunit, ATPase, 1
dog(100688636) proteasome (prosome, macropain) 26S subunit, ATPase, 1
domestic cat(101094025) proteasome (prosome, macropain) 26S subunit, ATPase, 1
Horse(100062573) proteasome (prosome, macropain) 26S subunit, ATPase, 1
cow(506238) proteasome (prosome, macropain) 26S subunit, ATPase, 1
sheep(101120165) proteasome (prosome, macropain) 26S subunit, ATPase, 1
domestic guinea pig(100733985) proteasome (prosome, macropain) 26S subunit, ATPase, 1
naked mole-rat(101698658) proteasome (prosome, macropain) 26S subunit, ATPase, 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C6706 Z-Leu-Leu-Norvalinal ≥90% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002802 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198931 MISSION® esiRNA esiRNA targeting mouse Psmc1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002802 Rosetta Predictions human pricing
NM_057123 Rosetta Predictions rat pricing
NM_008947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334464 predicted 1123
2 SASI_Hs02_00334465 predicted 886
3 SASI_Hs02_00334466 predicted 1270
4 SASI_Hs01_00110218 predicted 1353
5 SASI_Hs02_00334467 predicted 848
6 SASI_Hs02_00334468 predicted 835
7 SASI_Hs02_00334469 predicted 1031
8 SASI_Hs02_00334470 predicted 408
9 SASI_Hs02_00334471 predicted 1226
10 SASI_Hs02_00334472 predicted 240
11 SASI_Hs01_00110219 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088967 predicted 1250
2 SASI_Rn01_00088968 predicted 917
3 SASI_Rn01_00088969 predicted 353
4 SASI_Rn01_00088970 predicted 617
5 SASI_Rn01_00088971 predicted 293
6 SASI_Rn01_00088972 predicted 927
7 SASI_Rn01_00088973 predicted 1239
8 SASI_Rn01_00088975 predicted 1050
9 SASI_Rn01_00088976 predicted 451
10 SASI_Rn02_00267067 predicted 1279
11 SASI_Rn01_00088974 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072494 predicted 409
2 SASI_Mm02_00315002 predicted 337
3 SASI_Mm02_00315003 predicted 325
4 SASI_Mm02_00315004 predicted 327
5 SASI_Mm02_00315005 predicted 733
6 SASI_Mm02_00315006 predicted 339
7 SASI_Mm02_00315007 predicted 726
8 SASI_Mm02_00315008 predicted 370
9 SASI_Mm02_00315009 predicted 584
10 SASI_Mm01_00072495 predicted 629
11 SASI_Mm01_00072496 predicted 1429
12 SASI_Mm01_00072497 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008947
VALIDATED
PSMC1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-620s21c1
Sequence:CCGGCTTACCCATCCTGAGTATTACCTCGAGGTAATACTCAGGATGGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-336s21c1
Sequence:CCGGGAACCTTGGAAGAGATCATTGCTCGAGCAATGATCTCTTCCAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-402s21c1
Sequence:CCGGACGTCAGCATCCTGTCGTTTGCTCGAGCAAACGACAGGATGCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-989s21c1
Sequence:CCGGATCATGGCCACAAACCGAATACTCGAGTATTCGGTTTGTGGCCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-548s21c1
Sequence:CCGGCAGGAGACCTACGCAGATATTCTCGAGAATATCTGCGTAGGTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1335s1c1
Sequence:CCGGCCCACAGTCGTCCTCAGGGATCTCGAGATCCCTGAGGACGACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1236s1c1
Sequence:CCGGCGCAGAATGAAAGTAACAAATCTCGAGATTTGTTACTTTCATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1186s1c1
Sequence:CCGGCCGACATCAAGGCAATCTGTACTCGAGTACAGATTGCCTTGATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008947.1-926s1c1
Sequence:CCGGGCGAACAATGTTGGAACTGTTCTCGAGAACAGTTCCAACATTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-843s1c1
Sequence:CCGGCCGTCCATCGTGTTCATTGATCTCGAGATCAATGAACACGATGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008947
VALIDATED
PSMC1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-620s21c1
Sequence:CCGGCTTACCCATCCTGAGTATTACCTCGAGGTAATACTCAGGATGGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-336s21c1
Sequence:CCGGGAACCTTGGAAGAGATCATTGCTCGAGCAATGATCTCTTCCAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-402s21c1
Sequence:CCGGACGTCAGCATCCTGTCGTTTGCTCGAGCAAACGACAGGATGCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-989s21c1
Sequence:CCGGATCATGGCCACAAACCGAATACTCGAGTATTCGGTTTGTGGCCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-548s21c1
Sequence:CCGGCAGGAGACCTACGCAGATATTCTCGAGAATATCTGCGTAGGTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1335s1c1
Sequence:CCGGCCCACAGTCGTCCTCAGGGATCTCGAGATCCCTGAGGACGACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1236s1c1
Sequence:CCGGCGCAGAATGAAAGTAACAAATCTCGAGATTTGTTACTTTCATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1186s1c1
Sequence:CCGGCCGACATCAAGGCAATCTGTACTCGAGTACAGATTGCCTTGATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008947.1-926s1c1
Sequence:CCGGGCGAACAATGTTGGAACTGTTCTCGAGAACAGTTCCAACATTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-843s1c1
Sequence:CCGGCCGTCCATCGTGTTCATTGATCTCGAGATCAATGAACACGATGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008947
VALIDATED
PSMC1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-620s21c1
Sequence:CCGGCTTACCCATCCTGAGTATTACCTCGAGGTAATACTCAGGATGGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-336s21c1
Sequence:CCGGGAACCTTGGAAGAGATCATTGCTCGAGCAATGATCTCTTCCAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-402s21c1
Sequence:CCGGACGTCAGCATCCTGTCGTTTGCTCGAGCAAACGACAGGATGCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-989s21c1
Sequence:CCGGATCATGGCCACAAACCGAATACTCGAGTATTCGGTTTGTGGCCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008947.3-548s21c1
Sequence:CCGGCAGGAGACCTACGCAGATATTCTCGAGAATATCTGCGTAGGTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1335s1c1
Sequence:CCGGCCCACAGTCGTCCTCAGGGATCTCGAGATCCCTGAGGACGACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1236s1c1
Sequence:CCGGCGCAGAATGAAAGTAACAAATCTCGAGATTTGTTACTTTCATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-1186s1c1
Sequence:CCGGCCGACATCAAGGCAATCTGTACTCGAGTACAGATTGCCTTGATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008947.1-926s1c1
Sequence:CCGGGCGAACAATGTTGGAACTGTTCTCGAGAACAGTTCCAACATTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008947.1-843s1c1
Sequence:CCGGCCGTCCATCGTGTTCATTGATCTCGAGATCAATGAACACGATGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002802
VALIDATED
PSMC1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-678s21c1
Sequence:CCGGTTATGAAGAGATGGGTATAAACTCGAGTTTATACCCATCTCTTCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-210s21c1
Sequence:CCGGTCACACTCAGTGCCGGTTAAACTCGAGTTTAACCGGCACTGAGTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-1405s21c1
Sequence:CCGGAGATTTCTCAATCCCTGAAAGCTCGAGCTTTCAGGGATTGAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-589s21c1
Sequence:CCGGCAGGAGACCTATGCAGATATTCTCGAGAATATCTGCATAGGTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-879s21c1
Sequence:CCGGTGCACCGTCCATCGTGTTTATCTCGAGATAAACACGATGGACGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-755s1c1
Sequence:CCGGCCAAAGCAGTAGCAAACCAAACTCGAGTTTGGTTTGCTACTGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-880s1c1
Sequence:CCGGGCACCGTCCATCGTGTTTATTCTCGAGAATAAACACGATGGACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-559s1c1
Sequence:CCGGGTCACAGTGATGAAGGTAGAACTCGAGTTCTACCTTCATCACTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-436s1c1
Sequence:CCGGGAACACTACGTCAGCATTCTTCTCGAGAAGAATGCTGACGTAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-808s1c1
Sequence:CCGGGAACTTATTCAGAAGTACCTACTCGAGTAGGTACTTCTGAATAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002802
VALIDATED
PSMC1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-678s21c1
Sequence:CCGGTTATGAAGAGATGGGTATAAACTCGAGTTTATACCCATCTCTTCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-210s21c1
Sequence:CCGGTCACACTCAGTGCCGGTTAAACTCGAGTTTAACCGGCACTGAGTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-1405s21c1
Sequence:CCGGAGATTTCTCAATCCCTGAAAGCTCGAGCTTTCAGGGATTGAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-589s21c1
Sequence:CCGGCAGGAGACCTATGCAGATATTCTCGAGAATATCTGCATAGGTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-879s21c1
Sequence:CCGGTGCACCGTCCATCGTGTTTATCTCGAGATAAACACGATGGACGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-755s1c1
Sequence:CCGGCCAAAGCAGTAGCAAACCAAACTCGAGTTTGGTTTGCTACTGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-880s1c1
Sequence:CCGGGCACCGTCCATCGTGTTTATTCTCGAGAATAAACACGATGGACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-559s1c1
Sequence:CCGGGTCACAGTGATGAAGGTAGAACTCGAGTTCTACCTTCATCACTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-436s1c1
Sequence:CCGGGAACACTACGTCAGCATTCTTCTCGAGAAGAATGCTGACGTAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-808s1c1
Sequence:CCGGGAACTTATTCAGAAGTACCTACTCGAGTAGGTACTTCTGAATAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002802
VALIDATED
PSMC1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-678s21c1
Sequence:CCGGTTATGAAGAGATGGGTATAAACTCGAGTTTATACCCATCTCTTCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-210s21c1
Sequence:CCGGTCACACTCAGTGCCGGTTAAACTCGAGTTTAACCGGCACTGAGTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-1405s21c1
Sequence:CCGGAGATTTCTCAATCCCTGAAAGCTCGAGCTTTCAGGGATTGAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-589s21c1
Sequence:CCGGCAGGAGACCTATGCAGATATTCTCGAGAATATCTGCATAGGTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002802.2-879s21c1
Sequence:CCGGTGCACCGTCCATCGTGTTTATCTCGAGATAAACACGATGGACGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-755s1c1
Sequence:CCGGCCAAAGCAGTAGCAAACCAAACTCGAGTTTGGTTTGCTACTGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-880s1c1
Sequence:CCGGGCACCGTCCATCGTGTTTATTCTCGAGAATAAACACGATGGACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-559s1c1
Sequence:CCGGGTCACAGTGATGAAGGTAGAACTCGAGTTCTACCTTCATCACTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002802.2-436s1c1
Sequence:CCGGGAACACTACGTCAGCATTCTTCTCGAGAAGAATGCTGACGTAGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002802.2-808s1c1
Sequence:CCGGGAACTTATTCAGAAGTACCTACTCGAGTAGGTACTTCTGAATAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)