EMAIL THIS PAGE TO A FRIEND

PSMC2

proteasome (prosome, macropain) 26S subunit, ATPase, 2

61 Gene Product Result for
Synonyms: MSS1 Nbla10058 S7
UniProtKB ID: P35998, A4D0Q1, Q3LIA5, Q9UDI3
Gene ID:
Human(5701) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit has been shown to interact with several of the basal transcription factors so, in addition to participation in proteasome functions, this subunit may participate in the regulation of transcription. This subunit may also compete with PSMC3 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2011]
Mouse(19181) proteasome (prosome, macropain) 26S subunit, ATPase 2
Rat(25581) proteasome (prosome, macropain) 26S subunit, ATPase 2
Zebrafish(393941) proteasome (prosome, macropain) 26S subunit, ATPase 2
Horse(100058456) proteasome (prosome, macropain) 26S subunit, ATPase, 2
domestic cat(101086215) proteasome (prosome, macropain) 26S subunit, ATPase, 2
dog(475896) proteasome (prosome, macropain) 26S subunit, ATPase, 2
chicken(417716) proteasome (prosome, macropain) 26S subunit, ATPase, 2
cow(530186) proteasome (prosome, macropain) 26S subunit, ATPase, 2
sheep(101119977) proteasome (prosome, macropain) 26S subunit, ATPase, 2
naked mole-rat(101721422) proteasome (prosome, macropain) 26S subunit, ATPase, 2
domestic guinea pig(100723641) proteasome (prosome, macropain) 26S subunit, ATPase, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002803 Rosetta Predictions human pricing
NM_033236 Rosetta Predictions rat pricing
NM_011188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126910 predicted 1140
2 SASI_Hs01_00126911 predicted 420
3 SASI_Hs01_00126915 predicted 704
4 SASI_Hs01_00126917 predicted 1021
5 SASI_Hs02_00334473 predicted 661
6 SASI_Hs02_00334474 predicted 660
7 SASI_Hs02_00334475 predicted 1025
8 SASI_Hs01_00126908 predicted 258
9 SASI_Hs01_00126912 predicted 207
10 SASI_Hs01_00126913 predicted 1193
11 SASI_Hs01_00126909 predicted 552
12 SASI_Hs01_00126914 predicted 1171
13 SASI_Hs01_00126916 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071358 predicted 300
2 SASI_Rn01_00071359 predicted 500
3 SASI_Rn01_00071360 predicted 304
4 SASI_Rn01_00071362 predicted 615
5 SASI_Rn01_00071363 predicted 498
6 SASI_Rn01_00071364 predicted 564
7 SASI_Rn01_00071365 predicted 369
8 SASI_Rn01_00071366 predicted 206
9 SASI_Rn01_00071367 predicted 551
10 SASI_Rn02_00265520 predicted 264
11 SASI_Rn01_00071361 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194188 predicted 878
2 SASI_Mm01_00194189 predicted 1285
3 SASI_Mm01_00194190 predicted 583
4 SASI_Mm01_00194191 predicted 669
5 SASI_Mm01_00194193 predicted 627
6 SASI_Mm01_00194194 predicted 1086
7 SASI_Mm01_00194195 predicted 938
8 SASI_Mm01_00194196 predicted 911
9 SASI_Mm01_00194197 predicted 1017
10 SASI_Mm02_00320098 predicted 946
11 SASI_Mm01_00194192 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011188
VALIDATED
PSMC2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-504s21c1
Sequence:CCGGCTTACGGCCAAAGTACTTATTCTCGAGAATAAGTACTTTGGCCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-577s21c1
Sequence:CCGGTAATGAGCTCACTGGTATTAACTCGAGTTAATACCAGTGAGCTCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1103s21c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1451s21c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-1105s1c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-822s1c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011188.1-1453s1c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-820s21c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011188
VALIDATED
PSMC2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-504s21c1
Sequence:CCGGCTTACGGCCAAAGTACTTATTCTCGAGAATAAGTACTTTGGCCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-577s21c1
Sequence:CCGGTAATGAGCTCACTGGTATTAACTCGAGTTAATACCAGTGAGCTCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1103s21c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1451s21c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-1105s1c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-822s1c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011188.1-1453s1c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-820s21c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011188
VALIDATED
PSMC2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-504s21c1
Sequence:CCGGCTTACGGCCAAAGTACTTATTCTCGAGAATAAGTACTTTGGCCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-577s21c1
Sequence:CCGGTAATGAGCTCACTGGTATTAACTCGAGTTAATACCAGTGAGCTCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1103s21c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-1451s21c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-1105s1c1
Sequence:CCGGGCTTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011188.1-822s1c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011188.1-1453s1c1
Sequence:CCGGCGAACGCACATCTTTAAGATTCTCGAGAATCTTAAAGATGTGCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011188.3-820s21c1
Sequence:CCGGCGGTGTGGACAGAAATAAATACTCGAGTATTTATTTCTGTCCACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002803
VALIDATED
PSMC2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-773s21c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-533s21c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-875s21c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-533s1c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002803.2-1375s21c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-875s1c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1375s1c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-773s1c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1069s1c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-1069s21c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002803
VALIDATED
PSMC2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-773s21c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-533s21c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-875s21c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-533s1c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002803.2-1375s21c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-875s1c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1375s1c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-773s1c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1069s1c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-1069s21c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002803
VALIDATED
PSMC2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-773s21c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-533s21c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-875s21c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-533s1c1
Sequence:CCGGCCTAAGATTGACCCAACAGTTCTCGAGAACTGTTGGGTCAATCTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002803.2-1375s21c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-875s1c1
Sequence:CCGGGCCTGCCTTATCTTCTTTGATCTCGAGATCAAAGAAGATAAGGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1375s1c1
Sequence:CCGGCCTGAAGGCTTTCAAGTGAAACTCGAGTTTCACTTGAAAGCCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002803.2-773s1c1
Sequence:CCGGGCGTGCTTCATTCGAGTTATTCTCGAGAATAACTCGAATGAAGCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002803.2-1069s1c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002803.2-1069s21c1
Sequence:CCGGGCCAGGGAGATTGGATAGAAACTCGAGTTTCTATCCAATCTCCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)