EMAIL THIS PAGE TO A FRIEND

PSMC3

proteasome (prosome, macropain) 26S subunit, ATPase, 3

48 Gene Product Result for
Synonyms: TBP1
Gene ID:
Human(5702) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
Mouse(19182) proteasome (prosome, macropain) 26S subunit, ATPase 3
Rat(29677) proteasome (prosome, macropain) 26S subunit, ATPase 3
domestic guinea pig(100727371) proteasome (prosome, macropain) 26S subunit, ATPase, 3
naked mole-rat(101706267) proteasome (prosome, macropain) 26S subunit, ATPase, 3
Domestic Rabbit(100354000) proteasome (prosome, macropain) 26S subunit, ATPase, 3
cow(508448) proteasome (prosome, macropain) 26S subunit, ATPase, 3
sheep(101117873) proteasome (prosome, macropain) 26S subunit, ATPase, 3
Zebrafish(321947) proteasome (prosome, macropain) 26S subunit, ATPase, 3
chicken(423182) proteasome (prosome, macropain) 26S subunit, ATPase, 3
dog(475980) proteasome (prosome, macropain) 26S subunit, ATPase, 3
Horse(100051468) proteasome (prosome, macropain) 26S subunit, ATPase, 3
domestic cat(101095435) proteasome (prosome, macropain) 26S subunit, ATPase, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002804 Rosetta Predictions human pricing
NM_031595 Rosetta Predictions rat pricing
NM_008948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334476 predicted 219
2 SASI_Hs01_00212562 predicted 1172
3 SASI_Hs01_00212563 predicted 564
4 SASI_Hs02_00334477 predicted 198
5 SASI_Hs01_00212566 predicted 1320
6 SASI_Hs01_00212567 predicted 580
7 SASI_Hs02_00334478 predicted 1139
8 SASI_Hs01_00212568 predicted 1181
9 SASI_Hs02_00334479 predicted 216
10 SASI_Hs01_00212569 predicted 250
11 SASI_Hs01_00212561 predicted 756
12 SASI_Hs01_00212564 predicted 516
13 SASI_Hs01_00212565 predicted 604
14 SASI_Hs01_00212570 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076479 predicted 1227
2 SASI_Rn01_00076480 predicted 836
3 SASI_Rn01_00076481 predicted 1355
4 SASI_Rn01_00076482 predicted 585
5 SASI_Rn01_00076483 predicted 1066
6 SASI_Rn02_00264868 predicted 379
7 SASI_Rn01_00076485 predicted 482
8 SASI_Rn01_00076486 predicted 639
9 SASI_Rn01_00076487 predicted 1282
10 SASI_Rn01_00076488 predicted 431
11 SASI_Rn01_00076484 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144739 predicted 1309
2 SASI_Mm01_00144740 predicted 534
3 SASI_Mm01_00144741 predicted 371
4 SASI_Mm01_00144742 predicted 441
5 SASI_Mm01_00144743 predicted 1225
6 SASI_Mm01_00144744 predicted 1161
7 SASI_Mm01_00144745 predicted 1168
8 SASI_Mm01_00144746 predicted 311
9 SASI_Mm01_00144747 predicted 788
10 SASI_Mm01_00144748 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008948
VALIDATED
PSMC3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-862s21c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-343s21c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-287s1c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1341s1c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1232s1c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-806s1c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-1150s1c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1206s21c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1397s21c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1288s21c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008948
VALIDATED
PSMC3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-862s21c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-343s21c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-287s1c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1341s1c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1232s1c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-806s1c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-1150s1c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1206s21c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1397s21c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1288s21c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008948
VALIDATED
PSMC3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-862s21c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-343s21c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-287s1c1
Sequence:CCGGCAAGATGTCCACGGAAGAGATCTCGAGATCTCTTCCGTGGACATCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1341s1c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008948.1-1232s1c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-806s1c1
Sequence:CCGGCCACAAAGAGAAGTTTGAGAACTCGAGTTCTCAAACTTCTCTTTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008948.1-1150s1c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1206s21c1
Sequence:CCGGCCAACACTCAAGTGAAGGTAACTCGAGTTACCTTCACTTGAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1397s21c1
Sequence:CCGGCGGTGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008948.2-1288s21c1
Sequence:CCGGCCGCAAGATTGAGTTTCCAATCTCGAGATTGGAAACTCAATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002804
VALIDATED
PSMC3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002804.4-479s21c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-357s1c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-928s1c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-1119s1c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-444s1c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-702s1c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-1154s21c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-963s21c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-737s21c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-392s21c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002804
VALIDATED
PSMC3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002804.4-479s21c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-357s1c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-928s1c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-1119s1c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-444s1c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-702s1c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-1154s21c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-963s21c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-737s21c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-392s21c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002804
VALIDATED
PSMC3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002804.4-479s21c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-357s1c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-928s1c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-1119s1c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-444s1c1
Sequence:CCGGGCTCCTGGATGTTGATCCTAACTCGAGTTAGGATCAACATCCAGGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002804.3-702s1c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-1154s21c1
Sequence:CCGGCCAGCCCAACACCCAAGTTAACTCGAGTTAACTTGGGTGTTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-963s21c1
Sequence:CCGGGTGCAGATGTTCATTGGAGATCTCGAGATCTCCAATGAACATCTGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-737s21c1
Sequence:CCGGCACGGAGCAATACAGTGACATCTCGAGATGTCACTGTATTGCTCCGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002804.4-392s21c1
Sequence:CCGGCCAAGCCATGAAGGACAAGATCTCGAGATCTTGTCCTTCATGGCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)