EMAIL THIS PAGE TO A FRIEND

PSMC3IP

PSMC3 interacting protein

61 Gene Product Result for
Synonyms: GT198 HOP2 HUMGT198A ODG3 TBPIP
UniProtKB ID: Q9P2W1, Q14458, Q8WXG2, Q96HA2
Gene ID:
Human(29893) Summary: This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Mouse(19183) proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein
Rat(140938) PSMC3 interacting protein
Zebrafish(415214) PSMC3 interacting protein
domestic cat(101098417) PSMC3 interacting protein
chicken(772119) PSMC3 interacting protein
dog(607659) PSMC3 interacting protein
cow(508530) PSMC3 interacting protein
sheep(101103491) PSMC3 interacting protein
Goat(100861043) PSMC3 interacting protein
naked mole-rat(101717812) PSMC3 interacting protein
domestic guinea pig(100719118) PSMC3 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114291 MISSION® esiRNA esiRNA human PSMC3IP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013290 Rosetta Predictions human pricing
NM_016556 Rosetta Predictions human pricing
NM_134458 Rosetta Predictions rat pricing
NM_008949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199206 predicted 529
2 SASI_Hs01_00199207 predicted 366
3 SASI_Hs01_00199209 predicted 405
4 SASI_Hs01_00199210 predicted 562
5 SASI_Hs01_00199211 predicted 698
6 SASI_Hs01_00199212 predicted 530
7 SASI_Hs01_00199213 predicted 247
8 SASI_Hs01_00199214 predicted 550
9 SASI_Hs01_00199215 predicted 532
10 SASI_Hs02_00344562 predicted 338
11 SASI_Hs01_00199208 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015927 predicted 466
2 SASI_Hs01_00015928 predicted 255
3 SASI_Hs01_00015930 predicted 293
4 SASI_Hs01_00015931 predicted 498
5 SASI_Hs01_00015932 predicted 375
6 SASI_Hs01_00015933 predicted 621
7 SASI_Hs01_00015934 predicted 458
8 SASI_Hs01_00015935 predicted 478
9 SASI_Hs01_00015936 predicted 464
10 SASI_Hs02_00349675 predicted 233
11 SASI_Hs01_00015929 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058378 predicted 595
2 SASI_Rn02_00268055 predicted 208
3 SASI_Rn01_00058379 predicted 506
4 SASI_Rn01_00058380 predicted 633
5 SASI_Rn01_00058381 predicted 210
6 SASI_Rn01_00058382 predicted 275
7 SASI_Rn01_00058383 predicted 511
8 SASI_Rn01_00058384 predicted 286
9 SASI_Rn01_00058385 predicted 516
10 SASI_Rn02_00268056 predicted 510
11 SASI_Rn01_00058386 predicted 355
12 SASI_Rn01_00058387 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177328 predicted 305
2 SASI_Mm02_00315010 predicted 528
3 SASI_Mm01_00177330 predicted 640
4 SASI_Mm01_00177331 predicted 532
5 SASI_Mm01_00177332 predicted 533
6 SASI_Mm01_00177333 predicted 486
7 SASI_Mm01_00177334 predicted 504
8 SASI_Mm01_00177335 predicted 248
9 SASI_Mm01_00177337 predicted 476
10 SASI_Mm02_00315011 predicted 392
11 SASI_Mm01_00177329 predicted 623
12 SASI_Mm01_00177336 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013290
VALIDATED
PSMC3IP MISSION shRNA Bacterial Glycerol Stock
PSMC3 interacting protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-558s21c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-624s21c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-238s21c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013290.3-667s1c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-551s1c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013290.3-962s1c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-347s1c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-442s21c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-325s1c1
Sequence:CCGGGCAAGATCAAAGAGAAGATGTCTCGAGACATCTTCTCTTTGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-733s1c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-495s1c1
Sequence:CCGGCAGAAAGAAATCCAGGAGTTACTCGAGTAACTCCTGGATTTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013290.5-853s21c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013290
VALIDATED
PSMC3IP MISSION shRNA shRNA Plasmid DNA
PSMC3 interacting protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-558s21c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-624s21c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-238s21c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013290.3-667s1c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-551s1c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013290.3-962s1c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-347s1c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-442s21c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-325s1c1
Sequence:CCGGGCAAGATCAAAGAGAAGATGTCTCGAGACATCTTCTCTTTGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-733s1c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-495s1c1
Sequence:CCGGCAGAAAGAAATCCAGGAGTTACTCGAGTAACTCCTGGATTTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013290.5-853s21c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013290
VALIDATED
PSMC3IP MISSION shRNA Lentiviral Transduction Particles
PSMC3 interacting protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-558s21c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-624s21c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-238s21c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013290.3-667s1c1
Sequence:CCGGCTGATGCAATACTTGAAGGATCTCGAGATCCTTCAAGTATTGCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-551s1c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013290.3-962s1c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-347s1c1
Sequence:CCGGCGGCAAGCAGAAGATCTATTTCTCGAGAAATAGATCTTCTGCTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013290.5-442s21c1
Sequence:CCGGGAACATTAAAGCAGCTACCAACTCGAGTTGGTAGCTGCTTTAATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-325s1c1
Sequence:CCGGGCAAGATCAAAGAGAAGATGTCTCGAGACATCTTCTCTTTGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-733s1c1
Sequence:CCGGCGGATGAAGATTACAACGTCACTCGAGTGACGTTGTAATCTTCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013290.3-495s1c1
Sequence:CCGGCAGAAAGAAATCCAGGAGTTACTCGAGTAACTCCTGGATTTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013290.5-853s21c1
Sequence:CCGGCCAGCCCATTTCATTGTCTAACTCGAGTTAGACAATGAAATGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008949
VALIDATED
PSMC3IP MISSION shRNA Bacterial Glycerol Stock
PSMC3 interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-251s21c1
Sequence:CCGGTTGCCGATCAGAACCAGTTTGCTCGAGCAAACTGGTTCTGATCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008949.2-200s21c1
Sequence:CCGGCCCAGGAAGGCAAGATCAAAGCTCGAGCTTTGATCTTGCCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-637s21c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-370s21c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008949.2-732s1c1
Sequence:CCGGCCACCTTACTTAGTGGCCTTTCTCGAGAAAGGCCACTAAGTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-724s21c1
Sequence:CCGGTGCGCTGGCCACCTTACTTAGCTCGAGCTAAGTAAGGTGGCCAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-370s1c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008949.2-216s1c1
Sequence:CCGGCAAAGAGAAGACCTACGGCAACTCGAGTTGCCGTAGGTCTTCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-637s1c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-129s1c1
Sequence:CCGGCGTGTTCGGAAACCTACAGAACTCGAGTTCTGTAGGTTTCCGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008949
VALIDATED
PSMC3IP MISSION shRNA shRNA Plasmid DNA
PSMC3 interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-251s21c1
Sequence:CCGGTTGCCGATCAGAACCAGTTTGCTCGAGCAAACTGGTTCTGATCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008949.2-200s21c1
Sequence:CCGGCCCAGGAAGGCAAGATCAAAGCTCGAGCTTTGATCTTGCCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-637s21c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-370s21c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008949.2-732s1c1
Sequence:CCGGCCACCTTACTTAGTGGCCTTTCTCGAGAAAGGCCACTAAGTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-724s21c1
Sequence:CCGGTGCGCTGGCCACCTTACTTAGCTCGAGCTAAGTAAGGTGGCCAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-370s1c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008949.2-216s1c1
Sequence:CCGGCAAAGAGAAGACCTACGGCAACTCGAGTTGCCGTAGGTCTTCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-637s1c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-129s1c1
Sequence:CCGGCGTGTTCGGAAACCTACAGAACTCGAGTTCTGTAGGTTTCCGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008949
VALIDATED
PSMC3IP MISSION shRNA Lentiviral Transduction Particles
PSMC3 interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-251s21c1
Sequence:CCGGTTGCCGATCAGAACCAGTTTGCTCGAGCAAACTGGTTCTGATCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008949.2-200s21c1
Sequence:CCGGCCCAGGAAGGCAAGATCAAAGCTCGAGCTTTGATCTTGCCTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-637s21c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-370s21c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008949.2-732s1c1
Sequence:CCGGCCACCTTACTTAGTGGCCTTTCTCGAGAAAGGCCACTAAGTAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008949.2-724s21c1
Sequence:CCGGTGCGCTGGCCACCTTACTTAGCTCGAGCTAAGTAAGGTGGCCAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-370s1c1
Sequence:CCGGGCCGAGCTGAAGGAATTAACACTCGAGTGTTAATTCCTTCAGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008949.2-216s1c1
Sequence:CCGGCAAAGAGAAGACCTACGGCAACTCGAGTTGCCGTAGGTCTTCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-637s1c1
Sequence:CCGGGAAGTTGGAATAGAGACAGATCTCGAGATCTGTCTCTATTCCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008949.2-129s1c1
Sequence:CCGGCGTGTTCGGAAACCTACAGAACTCGAGTTCTGTAGGTTTCCGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)