EMAIL THIS PAGE TO A FRIEND

PSMC4

proteasome (prosome, macropain) 26S subunit, ATPase, 4

62 Gene Product Result for
Synonyms: MIP224 RPT3 S6 TBP-7 TBP7
UniProtKB ID: P43686, Q96FV5, Q9UBM3, Q9UEX3
Gene ID:
Human(5704) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(23996) proteasome (prosome, macropain) 26S subunit, ATPase, 4
Rat(117262) proteasome (prosome, macropain) 26S subunit, ATPase, 4
Zebrafish(326884) proteasome (prosome, macropain) 26S subunit, ATPase, 4
dog(476459) proteasome (prosome, macropain) 26S subunit, ATPase, 4
Horse(100064604) proteasome (prosome, macropain) 26S subunit, ATPase, 4
domestic cat(101090224) proteasome (prosome, macropain) 26S subunit, ATPase, 4
domestic guinea pig(100727625) proteasome (prosome, macropain) 26S subunit, ATPase, 4
naked mole-rat(101717896) proteasome (prosome, macropain) 26S subunit, ATPase, 4
Domestic Rabbit(100341658) proteasome (prosome, macropain) 26S subunit, ATPase, 4
cow(510029) proteasome (prosome, macropain) 26S subunit, ATPase, 4
sheep(101117608) proteasome (prosome, macropain) 26S subunit, ATPase, 4
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001601 MISSION® esiRNA esiRNA targeting human PSMC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006503 Rosetta Predictions human pricing
NM_153001 Rosetta Predictions human pricing
NM_057122 Rosetta Predictions rat pricing
NM_011874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020980 predicted 1087
2 SASI_Hs01_00020981 predicted 592
3 SASI_Hs01_00020982 predicted 1142
4 SASI_Hs01_00020983 predicted 1104
5 SASI_Hs01_00020984 predicted 511
6 SASI_Hs01_00020987 predicted 842
7 SASI_Hs01_00020988 predicted 846
8 SASI_Hs01_00020989 predicted 937
9 SASI_Hs02_00341710 predicted 1038
10 SASI_Hs02_00341711 predicted 515
11 SASI_Hs01_00020985 predicted 685
12 SASI_Hs01_00020986 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021674 predicted 991
2 SASI_Hs01_00021675 predicted 494
3 SASI_Hs01_00021676 predicted 1049
4 SASI_Hs01_00021677 predicted 1006
5 SASI_Hs01_00021678 predicted 421
6 SASI_Hs01_00021681 predicted 751
7 SASI_Hs01_00021682 predicted 760
8 SASI_Hs01_00021683 predicted 837
9 SASI_Hs02_00366960 predicted 941
10 SASI_Hs02_00366961 predicted 421
11 SASI_Hs01_00021679 predicted 595
12 SASI_Hs01_00021680 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036285 predicted 735
2 SASI_Rn01_00036286 predicted 500
3 SASI_Rn01_00036287 predicted 882
4 SASI_Rn01_00036288 predicted 237
5 SASI_Rn01_00036290 predicted 825
6 SASI_Rn02_00267065 predicted 864
7 SASI_Rn01_00036291 predicted 372
8 SASI_Rn01_00036292 predicted 261
9 SASI_Rn01_00036293 predicted 244
10 SASI_Rn02_00267066 predicted 816
11 SASI_Rn01_00036289 predicted 702
12 SASI_Rn01_00036294 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321662 predicted 552
2 SASI_Mm01_00157435 predicted 770
3 SASI_Mm02_00321663 predicted 932
4 SASI_Mm01_00157436 predicted 624
5 SASI_Mm02_00321664 predicted 228
6 SASI_Mm01_00157438 predicted 880
7 SASI_Mm01_00157439 predicted 816
8 SASI_Mm01_00157441 predicted 879
9 SASI_Mm01_00157442 predicted 696
10 SASI_Mm02_00321665 predicted 976
11 SASI_Mm01_00157434 predicted 902
12 SASI_Mm01_00157437 predicted 574
13 SASI_Mm01_00157440 predicted 880
14 SASI_Mm01_00157443 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006503
VALIDATED
PSMC4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-1050s1c1
Sequence:CCGGGCCGCCAGAAGAGATTGATTTCTCGAGAAATCAATCTCTTCTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-293s1c1
Sequence:CCGGCCGCTGGTCATCGGACAATTTCTCGAGAAATTGTCCGATGACCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1237s1c1
Sequence:CCGGGAAAGCATACAAGACTGTCATCTCGAGATGACAGTCTTGTATGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1072s1c1
Sequence:CCGGCTCCACTATCACTAGCAAGATCTCGAGATCTTGCTAGTGATAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-817s1c1
Sequence:CCGGCATCATCTTCATAGACGAGATCTCGAGATCTCGTCTATGAAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-940s21c1
Sequence:CCGGGAATGTCAATGTCAAGGTAATCTCGAGATTACCTTGACATTGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-315s21c1
Sequence:CCGGTGGAGGCTGTGGATCAGAATACTCGAGTATTCTGATCCACAGCCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006503
VALIDATED
PSMC4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-1050s1c1
Sequence:CCGGGCCGCCAGAAGAGATTGATTTCTCGAGAAATCAATCTCTTCTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-293s1c1
Sequence:CCGGCCGCTGGTCATCGGACAATTTCTCGAGAAATTGTCCGATGACCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1237s1c1
Sequence:CCGGGAAAGCATACAAGACTGTCATCTCGAGATGACAGTCTTGTATGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1072s1c1
Sequence:CCGGCTCCACTATCACTAGCAAGATCTCGAGATCTTGCTAGTGATAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-817s1c1
Sequence:CCGGCATCATCTTCATAGACGAGATCTCGAGATCTCGTCTATGAAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-940s21c1
Sequence:CCGGGAATGTCAATGTCAAGGTAATCTCGAGATTACCTTGACATTGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-315s21c1
Sequence:CCGGTGGAGGCTGTGGATCAGAATACTCGAGTATTCTGATCCACAGCCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006503
VALIDATED
PSMC4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-1050s1c1
Sequence:CCGGGCCGCCAGAAGAGATTGATTTCTCGAGAAATCAATCTCTTCTGGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-293s1c1
Sequence:CCGGCCGCTGGTCATCGGACAATTTCTCGAGAAATTGTCCGATGACCAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1237s1c1
Sequence:CCGGGAAAGCATACAAGACTGTCATCTCGAGATGACAGTCTTGTATGCTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006503.2-1072s1c1
Sequence:CCGGCTCCACTATCACTAGCAAGATCTCGAGATCTTGCTAGTGATAGTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006503.2-817s1c1
Sequence:CCGGCATCATCTTCATAGACGAGATCTCGAGATCTCGTCTATGAAGATGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-940s21c1
Sequence:CCGGGAATGTCAATGTCAAGGTAATCTCGAGATTACCTTGACATTGACATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006503.2-315s21c1
Sequence:CCGGTGGAGGCTGTGGATCAGAATACTCGAGTATTCTGATCCACAGCCTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011874
VALIDATED
PSMC4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-503s1c1
Sequence:CCGGCCAGATGTGATGTATGCCGATCTCGAGATCGGCATACATCACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-1212s1c1
Sequence:CCGGCCAAGGACTTCGAGAAAGCATCTCGAGATGCTTTCTCGAAGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-577s1c1
Sequence:CCGGGCTTACACACTTCGAGCTGTACTCGAGTACAGCTCGAAGTGTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-721s1c1
Sequence:CCGGCTCGGAGTTTGTTCAGAAGTACTCGAGTACTTCTGAACAAACTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-892s1c1
Sequence:CCGGGCTGGAGCTACTGAATCAAATCTCGAGATTTGATTCAGTAGCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011874
VALIDATED
PSMC4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-503s1c1
Sequence:CCGGCCAGATGTGATGTATGCCGATCTCGAGATCGGCATACATCACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-1212s1c1
Sequence:CCGGCCAAGGACTTCGAGAAAGCATCTCGAGATGCTTTCTCGAAGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-577s1c1
Sequence:CCGGGCTTACACACTTCGAGCTGTACTCGAGTACAGCTCGAAGTGTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-721s1c1
Sequence:CCGGCTCGGAGTTTGTTCAGAAGTACTCGAGTACTTCTGAACAAACTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-892s1c1
Sequence:CCGGGCTGGAGCTACTGAATCAAATCTCGAGATTTGATTCAGTAGCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011874
VALIDATED
PSMC4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-503s1c1
Sequence:CCGGCCAGATGTGATGTATGCCGATCTCGAGATCGGCATACATCACATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-1212s1c1
Sequence:CCGGCCAAGGACTTCGAGAAAGCATCTCGAGATGCTTTCTCGAAGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011874.1-577s1c1
Sequence:CCGGGCTTACACACTTCGAGCTGTACTCGAGTACAGCTCGAAGTGTGTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-721s1c1
Sequence:CCGGCTCGGAGTTTGTTCAGAAGTACTCGAGTACTTCTGAACAAACTCCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011874.1-892s1c1
Sequence:CCGGGCTGGAGCTACTGAATCAAATCTCGAGATTTGATTCAGTAGCTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)