EMAIL THIS PAGE TO A FRIEND

PSMC5

proteasome (prosome, macropain) 26S subunit, ATPase, 5

60 Gene Product Result for
Synonyms: S8 SUG-1 SUG1 TBP10 TRIP1 p45 p45/SUG
Gene ID:
Human(5705) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(19184) protease (prosome, macropain) 26S subunit, ATPase 5
Rat(81827) proteasome (prosome, macropain) 26S subunit, ATPase, 5
cow(282015) proteasome (prosome, macropain) 26S subunit, ATPase, 5
sheep(101104076) proteasome (prosome, macropain) 26S subunit, ATPase, 5
naked mole-rat(101710432) proteasome (prosome, macropain) 26S subunit, ATPase, 5
domestic guinea pig(100717173) proteasome (prosome, macropain) 26S subunit, ATPase, 5
Zebrafish(445285) proteasome (prosome, macropain) 26S subunit, ATPase, 5
chicken(428274) proteasome (prosome, macropain) 26S subunit, ATPase, 5
Horse(100053987) proteasome (prosome, macropain) 26S subunit, ATPase, 5
domestic cat(101097360) proteasome (prosome, macropain) 26S subunit, ATPase, 5
dog(480478) proteasome (prosome, macropain) 26S subunit, ATPase, 5
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22829 Anti-PSMC5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human
western blot pricing
HPA017871 Anti-PSMC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV38192 Anti-PSMC5 antibody produced in rabbit IgG fraction of antiserum rabbit, horse, Caenorhabditis elegans, human, canine, mouse, rat, guinea pig, zebrafish, bovine, pig
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2702005 Anti-PSMC5 antibody produced in rabbit rat, mouse, human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702087 Anti-PSMC5 antibody produced in rabbit mouse, human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA064293 Anti-PSMC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702171 Monoclonal Anti-PSMC5 antibody produced in mouse human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002805 Rosetta Predictions human pricing
NM_031149 Rosetta Predictions rat pricing
NM_008950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334480 predicted 472
2 SASI_Hs01_00052030 predicted 418
3 SASI_Hs02_00334481 predicted 679
4 SASI_Hs01_00052031 predicted 471
5 SASI_Hs01_00052032 predicted 362
6 SASI_Hs01_00052033 predicted 301
7 SASI_Hs01_00052034 predicted 300
8 SASI_Hs01_00052035 predicted 314
9 SASI_Hs01_00052036 predicted 461
10 SASI_Hs01_00052037 predicted 540
11 SASI_Hs01_00052028 predicted 468
12 SASI_Hs01_00052029 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046190 predicted 854
2 SASI_Rn01_00046191 predicted 890
3 SASI_Rn01_00046192 predicted 310
4 SASI_Rn01_00046193 predicted 380
5 SASI_Rn01_00046195 predicted 875
6 SASI_Rn01_00046196 predicted 440
7 SASI_Rn01_00046197 predicted 859
8 SASI_Rn01_00046198 predicted 709
9 SASI_Rn01_00046199 predicted 389
10 SASI_Rn02_00264492 predicted 291
11 SASI_Rn01_00046194 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031903 predicted 371
2 SASI_Mm01_00031904 predicted 880
3 SASI_Mm02_00315012 predicted 616
4 SASI_Mm01_00031905 predicted 326
5 SASI_Mm01_00031906 predicted 871
6 SASI_Mm01_00031907 predicted 748
7 SASI_Mm01_00031910 predicted 879
8 SASI_Mm02_00315013 predicted 702
9 SASI_Mm01_00031911 predicted 874
10 SASI_Mm01_00031912 predicted 715
11 SASI_Mm01_00031908 predicted 444
12 SASI_Mm01_00031909 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008950
VALIDATED
PSMC5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-860s1c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-145s1c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-653s1c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-348s1c1
Sequence:CCGGCGCTCTAAGAAATGACAGCTACTCGAGTAGCTGTCATTTCTTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-66s1c1
Sequence:CCGGCCGTCAATATTATCTGTCCAACTCGAGTTGGACAGATAATATTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-320s21c1
Sequence:CCGGTCAACGATGTGACGCCCAATTCTCGAGAATTGGGCGTCACATCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-860s21c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-653s21c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-145s21c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-271s21c1
Sequence:CCGGGTCCATCCTGAGGGCAAATTTCTCGAGAAATTTGCCCTCAGGATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008950
VALIDATED
PSMC5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-860s1c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-145s1c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-653s1c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-348s1c1
Sequence:CCGGCGCTCTAAGAAATGACAGCTACTCGAGTAGCTGTCATTTCTTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-66s1c1
Sequence:CCGGCCGTCAATATTATCTGTCCAACTCGAGTTGGACAGATAATATTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-320s21c1
Sequence:CCGGTCAACGATGTGACGCCCAATTCTCGAGAATTGGGCGTCACATCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-860s21c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-653s21c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-145s21c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-271s21c1
Sequence:CCGGGTCCATCCTGAGGGCAAATTTCTCGAGAAATTTGCCCTCAGGATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008950
VALIDATED
PSMC5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-860s1c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-145s1c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-653s1c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008950.1-348s1c1
Sequence:CCGGCGCTCTAAGAAATGACAGCTACTCGAGTAGCTGTCATTTCTTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008950.1-66s1c1
Sequence:CCGGCCGTCAATATTATCTGTCCAACTCGAGTTGGACAGATAATATTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-320s21c1
Sequence:CCGGTCAACGATGTGACGCCCAATTCTCGAGAATTGGGCGTCACATCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-860s21c1
Sequence:CCGGCCACCAAGAATATCAAGGTTACTCGAGTAACCTTGATATTCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-653s21c1
Sequence:CCGGGCTCTGAACTGGTACAGAAATCTCGAGATTTCTGTACCAGTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-145s21c1
Sequence:CCGGGCACAGAGGAATGAGCTGAATCTCGAGATTCAGCTCATTCCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008950.1-271s21c1
Sequence:CCGGGTCCATCCTGAGGGCAAATTTCTCGAGAAATTTGCCCTCAGGATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002805
VALIDATED
PSMC5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-180s1c1
Sequence:CCGGGCACAGAGGAACGAACTAAATCTCGAGATTTAGTTCGTTCCTCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-908s1c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-1028s1c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-764s1c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002805.4-506s1c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-908s21c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-506s21c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-1028s21c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-764s21c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002805
VALIDATED
PSMC5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-180s1c1
Sequence:CCGGGCACAGAGGAACGAACTAAATCTCGAGATTTAGTTCGTTCCTCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-908s1c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-1028s1c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-764s1c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002805.4-506s1c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-908s21c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-506s21c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-1028s21c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-764s21c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002805
VALIDATED
PSMC5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-180s1c1
Sequence:CCGGGCACAGAGGAACGAACTAAATCTCGAGATTTAGTTCGTTCCTCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-908s1c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-1028s1c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002805.4-764s1c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002805.4-506s1c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-908s21c1
Sequence:CCGGCAAGGTTATCATGGCTACTAACTCGAGTTAGTAGCCATGATAACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-506s21c1
Sequence:CCGGCAAACAGATCAAGGAGATCAACTCGAGTTGATCTCCTTGATCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-1028s21c1
Sequence:CCGGGAAGATTCATTCTCGGAAGATCTCGAGATCTTCCGAGAATGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002805.4-764s21c1
Sequence:CCGGTGCTCCATCTATCATCTTCATCTCGAGATGAAGATGATAGATGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)