EMAIL THIS PAGE TO A FRIEND

PSMC6

proteasome (prosome, macropain) 26S subunit, ATPase, 6

101 Gene Product Result for
Synonyms: CADP44 P44 SUG2 p42
UniProtKB ID: P62333, B2R975, P49719, Q6IBU3, Q92524
Gene ID:
Human(5706) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008]
Mouse(67089) proteasome (prosome, macropain) 26S subunit, ATPase, 6
Rat(289990) proteasome (prosome, macropain) 26S subunit, ATPase, 6
Zebrafish(321585) proteasome (prosome, macropain) 26S subunit, ATPase, 6
domestic cat(101098797) proteasome (prosome, macropain) 26S subunit, ATPase, 6
dog(478522) proteasome (prosome, macropain) 26S subunit, ATPase, 6
chicken(423586) proteasome (prosome, macropain) 26S subunit, ATPase, 6
domestic guinea pig(100732212) proteasome (prosome, macropain) 26S subunit, ATPase, 6
naked mole-rat(101716297) proteasome (prosome, macropain) 26S subunit, ATPase, 6
Domestic Rabbit(100353955) proteasome (prosome, macropain) 26S subunit, ATPase, 6
cow(518637) proteasome (prosome, macropain) 26S subunit, ATPase, 6
sheep(101116401) proteasome (prosome, macropain) 26S subunit, ATPase, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002806 Rosetta Predictions human pricing
XM_001072705 Rosetta Predictions rat pricing
XM_214147 Rosetta Predictions rat pricing
NM_025959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153003 predicted 720
2 SASI_Hs01_00153004 predicted 813
3 SASI_Hs01_00153005 predicted 591
4 SASI_Hs01_00153006 predicted 845
5 SASI_Hs02_00334482 predicted 657
6 SASI_Hs01_00153007 predicted 806
7 SASI_Hs02_00334483 predicted 640
8 SASI_Hs01_00153008 predicted 680
9 SASI_Hs01_00153009 predicted 1070
10 SASI_Hs01_00153012 predicted 413
11 SASI_Hs01_00153010 predicted 237
12 SASI_Hs01_00153011 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340189 predicted 814
2 SASI_Rn02_00340190 predicted 886
3 SASI_Rn02_00340191 predicted 467
4 SASI_Rn02_00340192 predicted 1010
5 SASI_Rn02_00340193 predicted 827
6 SASI_Rn02_00340194 predicted 1201
7 SASI_Rn02_00340195 predicted 648
8 SASI_Rn02_00340196 predicted 1110
9 SASI_Rn02_00340197 predicted 1079
10 SASI_Rn02_00340198 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375151 predicted 818
2 SASI_Rn02_00375152 predicted 886
3 SASI_Rn02_00375153 predicted 468
4 SASI_Rn02_00375154 predicted 1011
5 SASI_Rn02_00375155 predicted 828
6 SASI_Rn02_00375156 predicted 1201
7 SASI_Rn02_00375157 predicted 655
8 SASI_Rn02_00375158 predicted 1110
9 SASI_Rn02_00375159 predicted 1083
10 SASI_Rn02_00375160 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136235 predicted 978
2 SASI_Mm01_00136237 predicted 822
3 SASI_Mm01_00136238 predicted 938
4 SASI_Mm01_00136239 predicted 1079
5 SASI_Mm01_00136240 predicted 647
6 SASI_Mm01_00136241 predicted 728
7 SASI_Mm01_00136242 predicted 477
8 SASI_Mm01_00136243 predicted 798
9 SASI_Mm01_00136244 predicted 352
10 SASI_Mm02_00329360 predicted 1183
11 SASI_Mm01_00136236 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025959
PSMC6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-973s21c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-319s21c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025959.3-1270s21c1
Sequence:CCGGGTATTGGCAATGATCTTATTACTCGAGTAATAAGATCATTGCCAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-451s21c1
Sequence:CCGGCGGGAGTTAAGAGAGGTAATACTCGAGTATTACCTCTCTTAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-491s1c1
Sequence:CCGGCCAGAATTATTCCAGCGTGTACTCGAGTACACGCTGGAATAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-479s1c1
Sequence:CCGGCCTCTTACAAATCCAGAATTACTCGAGTAATTCTGGATTTGTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-898s1c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-974s1c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-320s1c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-897s21c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025959
PSMC6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-973s21c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-319s21c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025959.3-1270s21c1
Sequence:CCGGGTATTGGCAATGATCTTATTACTCGAGTAATAAGATCATTGCCAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-451s21c1
Sequence:CCGGCGGGAGTTAAGAGAGGTAATACTCGAGTATTACCTCTCTTAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-491s1c1
Sequence:CCGGCCAGAATTATTCCAGCGTGTACTCGAGTACACGCTGGAATAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-479s1c1
Sequence:CCGGCCTCTTACAAATCCAGAATTACTCGAGTAATTCTGGATTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-898s1c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-974s1c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-320s1c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-897s21c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025959
PSMC6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-973s21c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-319s21c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025959.3-1270s21c1
Sequence:CCGGGTATTGGCAATGATCTTATTACTCGAGTAATAAGATCATTGCCAATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-451s21c1
Sequence:CCGGCGGGAGTTAAGAGAGGTAATACTCGAGTATTACCTCTCTTAACTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-491s1c1
Sequence:CCGGCCAGAATTATTCCAGCGTGTACTCGAGTACACGCTGGAATAATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-479s1c1
Sequence:CCGGCCTCTTACAAATCCAGAATTACTCGAGTAATTCTGGATTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-898s1c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-974s1c1
Sequence:CCGGGCAGGACCTATTACAAAGCATCTCGAGATGCTTTGTAATAGGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025959.2-320s1c1
Sequence:CCGGGCTTTGGATATGACCACACTACTCGAGTAGTGTGGTCATATCCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025959.3-897s21c1
Sequence:CCGGCCCAGGAAGATTAGATAGAAACTCGAGTTTCTATCTAATCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002806
VALIDATED
PSMC6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-663s21c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-975s1c1
Sequence:CCGGCCCATTACAAAGCATGGTGAACTCGAGTTCACCATGCTTTGTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-486s1c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-474s1c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002806.2-641s1c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-1157s1c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-508s21c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-496s21c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002806.3-1179s21c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002806
VALIDATED
PSMC6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-663s21c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-975s1c1
Sequence:CCGGCCCATTACAAAGCATGGTGAACTCGAGTTCACCATGCTTTGTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-486s1c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-474s1c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002806.2-641s1c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-1157s1c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-508s21c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-496s21c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002806.3-1179s21c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002806
VALIDATED
PSMC6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, ATPase, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-663s21c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-975s1c1
Sequence:CCGGCCCATTACAAAGCATGGTGAACTCGAGTTCACCATGCTTTGTAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-486s1c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-474s1c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002806.2-641s1c1
Sequence:CCGGCATTGGTGAAAGTGCTCGTTTCTCGAGAAACGAGCACTTTCACCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002806.2-1157s1c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-508s21c1
Sequence:CCGGCCAGAGTTATTTCAGCGTGTACTCGAGTACACGCTGAAATAACTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002806.3-496s21c1
Sequence:CCGGCCTCTTACAAACCCAGAGTTACTCGAGTAACTCTGGGTTTGTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002806.3-1179s21c1
Sequence:CCGGGCTGGAGTCTAAATTGGACTACTCGAGTAGTCCAATTTAGACTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)