EMAIL THIS PAGE TO A FRIEND

PSMD10

proteasome (prosome, macropain) 26S subunit, non-ATPase, 10

113 Gene Product Result for
Synonyms: dJ889N15.2 p28 p28(GANK)
UniProtKB ID: O75832, Q5U0B2, Q8IZK9
Gene ID:
Human(5716) Summary: This gene encodes a subunit of the PA700/19S complex, which is the regulatory component of the 26S proteasome. The 26S proteosome complex is required for ubiquitin-dependent protein degradation. This protein is a non-ATPase subunit that may be involved in protein-protein interactions. Aberrant expression of this gene may paly a role in tumorigenesis. Two transcripts encoding different isoforms have been described. Pseudogenes have been identified on chromosomes 3 and 20.[provided by RefSeq, Mar 2011]
Mouse(53380) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Rat(116722) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
domestic guinea pig(100724287) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
naked mole-rat(101720372) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
cow(535414) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
sheep(101113657) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Zebrafish(403085) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
chicken(422351) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
dog(481014) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
domestic cat(101087906) proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002814 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002814 Rosetta Predictions human pricing
NM_170750 Rosetta Predictions human pricing
NM_053925 Rosetta Predictions rat pricing
NM_016883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180247 predicted 980
2 SASI_Hs01_00180248 predicted 308
3 SASI_Hs01_00180249 predicted 921
4 SASI_Hs02_00334500 predicted 853
5 SASI_Hs01_00180250 predicted 823
6 SASI_Hs01_00180251 predicted 988
7 SASI_Hs01_00180252 predicted 964
8 SASI_Hs01_00180253 predicted 991
9 SASI_Hs01_00180255 predicted 843
10 SASI_Hs02_00334501 predicted 821
11 SASI_Hs01_00180254 predicted 246
12 SASI_Hs01_00180256 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033526 predicted 899
2 SASI_Hs01_00033527 predicted 310
3 SASI_Hs01_00033528 predicted 842
4 SASI_Hs02_00367715 predicted 773
5 SASI_Hs01_00033529 predicted 750
6 SASI_Hs01_00033530 predicted 905
7 SASI_Hs01_00033531 predicted 881
8 SASI_Hs01_00033532 predicted 913
9 SASI_Hs01_00033534 predicted 765
10 SASI_Hs02_00367716 predicted 744
11 SASI_Hs01_00033533 predicted 254
12 SASI_Hs01_00033535 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056454 predicted 210
2 SASI_Rn01_00056455 predicted 213
3 SASI_Rn01_00056456 predicted 352
4 SASI_Rn01_00056457 predicted 442
5 SASI_Rn01_00056458 predicted 397
6 SASI_Rn01_00056459 predicted 348
7 SASI_Rn01_00056460 predicted 463
8 SASI_Rn02_00266872 predicted 204
9 SASI_Rn01_00056461 predicted 300
10 SASI_Rn01_00056462 predicted 389
11 SASI_Rn01_00056463 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097095 predicted 698
2 SASI_Mm01_00097097 predicted 685
3 SASI_Mm01_00097098 predicted 536
4 SASI_Mm01_00097099 predicted 379
5 SASI_Mm01_00097100 predicted 612
6 SASI_Mm01_00097102 predicted 603
7 SASI_Mm02_00323704 predicted 667
8 SASI_Mm01_00097104 predicted 498
9 SASI_Mm02_00323705 predicted 365
10 SASI_Mm02_00323706 predicted 707
11 SASI_Mm01_00097096 predicted 758
12 SASI_Mm01_00097101 predicted 473
13 SASI_Mm01_00097103 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016883
VALIDATED
PSMD10 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.4-232s21c1
Sequence:CCGGGAGTGCCAGTGAATGATAAAGCTCGAGCTTTATCATTCACTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-879s21c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-604s21c1
Sequence:CCGGTGACTCAAGGAGCAAGTATTTCTCGAGAAATACTTGCTCCTTGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-552s21c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-181s21c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016883.3-879s1c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-87s1c1
Sequence:CCGGGATGAGTTGAAGGAGCGCATTCTCGAGAATGCGCTCCTTCAACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-181s1c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016883.3-552s1c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-366s1c1
Sequence:CCGGGCAGCTTCGAAGAATAGGCATCTCGAGATGCCTATTCTTCGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016883
VALIDATED
PSMD10 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.4-232s21c1
Sequence:CCGGGAGTGCCAGTGAATGATAAAGCTCGAGCTTTATCATTCACTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-879s21c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-604s21c1
Sequence:CCGGTGACTCAAGGAGCAAGTATTTCTCGAGAAATACTTGCTCCTTGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-552s21c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-181s21c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016883.3-879s1c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-87s1c1
Sequence:CCGGGATGAGTTGAAGGAGCGCATTCTCGAGAATGCGCTCCTTCAACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-181s1c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016883.3-552s1c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-366s1c1
Sequence:CCGGGCAGCTTCGAAGAATAGGCATCTCGAGATGCCTATTCTTCGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016883
VALIDATED
PSMD10 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.4-232s21c1
Sequence:CCGGGAGTGCCAGTGAATGATAAAGCTCGAGCTTTATCATTCACTGGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-879s21c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-604s21c1
Sequence:CCGGTGACTCAAGGAGCAAGTATTTCTCGAGAAATACTTGCTCCTTGAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-552s21c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016883.3-181s21c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016883.3-879s1c1
Sequence:CCGGGCTTGTTCTACTGATGCCATTCTCGAGAATGGCATCAGTAGAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-87s1c1
Sequence:CCGGGATGAGTTGAAGGAGCGCATTCTCGAGAATGCGCTCCTTCAACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-181s1c1
Sequence:CCGGGCCATACAGAAATTGTTGAATCTCGAGATTCAACAATTTCTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016883.3-552s1c1
Sequence:CCGGCCTCTACACTTAGCCTGTGATCTCGAGATCACAGGCTAAGTGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016883.3-366s1c1
Sequence:CCGGGCAGCTTCGAAGAATAGGCATCTCGAGATGCCTATTCTTCGAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002814
VALIDATED
PSMD10 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-156s21c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-542s21c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002814.2-387s21c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-986s21c1
Sequence:CCGGGTTCTACTGTTGTCGTATATTCTCGAGAATATACGACAACAGTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-493s21c1
Sequence:CCGGCAGATGCTAAGGACCATTATGCTCGAGCATAATGGTCCTTAGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-181s1c1
Sequence:CCGGCCGATAAATCCCTGGCTACTACTCGAGTAGTAGCCAGGGATTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-542s1c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-387s1c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-156s1c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-291s1c1
Sequence:CCGGCCAGTGAATGATAAAGACGATCTCGAGATCGTCTTTATCATTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002814
VALIDATED
PSMD10 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-156s21c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-542s21c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002814.2-387s21c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-986s21c1
Sequence:CCGGGTTCTACTGTTGTCGTATATTCTCGAGAATATACGACAACAGTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-493s21c1
Sequence:CCGGCAGATGCTAAGGACCATTATGCTCGAGCATAATGGTCCTTAGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-181s1c1
Sequence:CCGGCCGATAAATCCCTGGCTACTACTCGAGTAGTAGCCAGGGATTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-542s1c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-387s1c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-156s1c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-291s1c1
Sequence:CCGGCCAGTGAATGATAAAGACGATCTCGAGATCGTCTTTATCATTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002814
VALIDATED
PSMD10 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-156s21c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-542s21c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002814.2-387s21c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-986s21c1
Sequence:CCGGGTTCTACTGTTGTCGTATATTCTCGAGAATATACGACAACAGTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002814.2-493s21c1
Sequence:CCGGCAGATGCTAAGGACCATTATGCTCGAGCATAATGGTCCTTAGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-181s1c1
Sequence:CCGGCCGATAAATCCCTGGCTACTACTCGAGTAGTAGCCAGGGATTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-542s1c1
Sequence:CCGGCAAGGGTAACTTGAAGATGATCTCGAGATCATCTTCAAGTTACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-387s1c1
Sequence:CCGGGCTCAAGTGAATGCTGTCAATCTCGAGATTGACAGCATTCACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002814.2-156s1c1
Sequence:CCGGGAAGAGTTGAAGGAGAGTATTCTCGAGAATACTCTCCTTCAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002814.2-291s1c1
Sequence:CCGGCCAGTGAATGATAAAGACGATCTCGAGATCGTCTTTATCATTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)