EMAIL THIS PAGE TO A FRIEND

PSMD11

proteasome (prosome, macropain) 26S subunit, non-ATPase, 11

61 Gene Product Result for
Synonyms: Rpn6 S9 p44.5
UniProtKB ID: O00231, A8K3I7, E1P663, O00495, Q53FT5
Gene ID:
Human(5717) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(69077) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Rat(303353) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
chicken(430878) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
domestic cat(101091665) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
dog(480610) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
cow(513461) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
sheep(101121105) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
naked mole-rat(101724437) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
domestic guinea pig(100718311) proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040561 MISSION® esiRNA esiRNA human PSMD11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002815 Rosetta Predictions human pricing
NM_001107027 Rosetta Predictions rat pricing
NM_178616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123189 predicted 739
2 SASI_Hs01_00123190 predicted 824
3 SASI_Hs01_00123191 predicted 678
4 SASI_Hs01_00123192 predicted 1006
5 SASI_Hs01_00123193 predicted 1297
6 SASI_Hs01_00123194 predicted 1078
7 SASI_Hs01_00123195 predicted 742
8 SASI_Hs02_00334502 predicted 559
9 SASI_Hs01_00123196 predicted 465
10 SASI_Hs01_00123198 predicted 1241
11 SASI_Hs01_00123197 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224766 predicted 1489
2 SASI_Rn02_00224767 predicted 1509
3 SASI_Rn02_00224768 predicted 1071
4 SASI_Rn02_00224769 predicted 866
5 SASI_Rn02_00224770 predicted 1619
6 SASI_Rn02_00224771 predicted 1337
7 SASI_Rn02_00224772 predicted 1103
8 SASI_Rn02_00224773 predicted 976
9 SASI_Rn02_00224774 predicted 1581
10 SASI_Rn02_00224775 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025122 predicted 570
2 SASI_Mm01_00025123 predicted 1090
3 SASI_Mm01_00025125 predicted 990
4 SASI_Mm01_00025126 predicted 1249
5 SASI_Mm01_00025127 predicted 1232
6 SASI_Mm01_00025129 predicted 836
7 SASI_Mm02_00348968 predicted 1160
8 SASI_Mm01_00025130 predicted 607
9 SASI_Mm02_00348969 predicted 325
10 SASI_Mm01_00025131 predicted 797
11 SASI_Mm01_00025124 predicted 472
12 SASI_Mm01_00025128 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178616
VALIDATED
PSMD11 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-135s21c1
Sequence:CCGGTCCATCGTGAAACGTGACATTCTCGAGAATGTCACGTTTCACGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178616.3-1566s21c1
Sequence:CCGGGGCTTACACTACCTAAAGCTGCTCGAGCAGCTTTAGGTAGTGTAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-283s21c1
Sequence:CCGGATTCCATCAGTAAAGCTAAAGCTCGAGCTTTAGCTTTACTGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1309s1c1
Sequence:CCGGGTTGGATCTGTAGCGGTCCTTCTCGAGAAGGACCGCTACAGATCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1068s1c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-986s1c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-306s1c1
Sequence:CCGGCGGTCTCTTCTTGATCTGTTTCTCGAGAAACAGATCAAGAAGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-1080s21c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178616.2-1008s1c1
Sequence:CCGGGCCAAGCTGTACGATAACTTACTCGAGTAAGTTATCGTACAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-998s21c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178616
VALIDATED
PSMD11 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-135s21c1
Sequence:CCGGTCCATCGTGAAACGTGACATTCTCGAGAATGTCACGTTTCACGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178616.3-1566s21c1
Sequence:CCGGGGCTTACACTACCTAAAGCTGCTCGAGCAGCTTTAGGTAGTGTAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-283s21c1
Sequence:CCGGATTCCATCAGTAAAGCTAAAGCTCGAGCTTTAGCTTTACTGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1309s1c1
Sequence:CCGGGTTGGATCTGTAGCGGTCCTTCTCGAGAAGGACCGCTACAGATCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1068s1c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-986s1c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-306s1c1
Sequence:CCGGCGGTCTCTTCTTGATCTGTTTCTCGAGAAACAGATCAAGAAGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-1080s21c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178616.2-1008s1c1
Sequence:CCGGGCCAAGCTGTACGATAACTTACTCGAGTAAGTTATCGTACAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-998s21c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178616
VALIDATED
PSMD11 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-135s21c1
Sequence:CCGGTCCATCGTGAAACGTGACATTCTCGAGAATGTCACGTTTCACGATGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178616.3-1566s21c1
Sequence:CCGGGGCTTACACTACCTAAAGCTGCTCGAGCAGCTTTAGGTAGTGTAAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-283s21c1
Sequence:CCGGATTCCATCAGTAAAGCTAAAGCTCGAGCTTTAGCTTTACTGATGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1309s1c1
Sequence:CCGGGTTGGATCTGTAGCGGTCCTTCTCGAGAAGGACCGCTACAGATCCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-1068s1c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-986s1c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178616.2-306s1c1
Sequence:CCGGCGGTCTCTTCTTGATCTGTTTCTCGAGAAACAGATCAAGAAGAGACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-1080s21c1
Sequence:CCGGCGAGTCCAGATTGAACACATACTCGAGTATGTGTTCAATCTGGACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178616.2-1008s1c1
Sequence:CCGGGCCAAGCTGTACGATAACTTACTCGAGTAAGTTATCGTACAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178616.3-998s21c1
Sequence:CCGGCCCAATCATCAGCACACATTTCTCGAGAAATGTGTGCTGATGATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002815
VALIDATED
PSMD11 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1116s21c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1430s21c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-437s21c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-670s21c1
Sequence:CCGGGGACATGCAGTCGGGTATTATCTCGAGATAATACCCGACTGCATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-126s21c1
Sequence:CCGGCCATCGTGAAGCGTGACATTCCTCGAGGAATGTCACGCTTCACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-1116s1c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-1071s1c1
Sequence:CCGGGAGTACAGATTGAACACATATCTCGAGATATGTGTTCAATCTGTACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-437s1c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002815.x-1430s1c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-169s1c1
Sequence:CCGGGCAAGTCAAAGAGCAGAGCATCTCGAGATGCTCTGCTCTTTGACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002815
VALIDATED
PSMD11 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1116s21c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1430s21c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-437s21c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-670s21c1
Sequence:CCGGGGACATGCAGTCGGGTATTATCTCGAGATAATACCCGACTGCATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-126s21c1
Sequence:CCGGCCATCGTGAAGCGTGACATTCCTCGAGGAATGTCACGCTTCACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-1116s1c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-1071s1c1
Sequence:CCGGGAGTACAGATTGAACACATATCTCGAGATATGTGTTCAATCTGTACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-437s1c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002815.x-1430s1c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-169s1c1
Sequence:CCGGGCAAGTCAAAGAGCAGAGCATCTCGAGATGCTCTGCTCTTTGACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002815
VALIDATED
PSMD11 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1116s21c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-1430s21c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-437s21c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-670s21c1
Sequence:CCGGGGACATGCAGTCGGGTATTATCTCGAGATAATACCCGACTGCATGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002815.2-126s21c1
Sequence:CCGGCCATCGTGAAGCGTGACATTCCTCGAGGAATGTCACGCTTCACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-1116s1c1
Sequence:CCGGCCGACGTGGAAAGGAAATTATCTCGAGATAATTTCCTTTCCACGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-1071s1c1
Sequence:CCGGGAGTACAGATTGAACACATATCTCGAGATATGTGTTCAATCTGTACTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002815.x-437s1c1
Sequence:CCGGCTGGTGTCTTTGTACTTTGATCTCGAGATCAAAGTACAAAGACACCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002815.x-1430s1c1
Sequence:CCGGCCTCATTTGGTGCATCTGTATCTCGAGATACAGATGCACCAAATGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002815.x-169s1c1
Sequence:CCGGGCAAGTCAAAGAGCAGAGCATCTCGAGATGCTCTGCTCTTTGACTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)