EMAIL THIS PAGE TO A FRIEND

PSMD12

proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

72 Gene Product Result for
Synonyms: Rpn5 p55
UniProtKB ID: O00232, A6NP15, Q53HA2, Q6P053
Gene ID:
Human(5718) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. [provided by RefSeq, Jul 2008]
Mouse(66997) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Rat(287772) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Zebrafish(321898) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
chicken(417425) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
dog(480465) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
domestic cat(101100851) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
domestic guinea pig(100719676) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
naked mole-rat(101714054) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Domestic Rabbit(100338269) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
cow(538204) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
sheep(101107714) proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174871 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070951 MISSION® esiRNA esiRNA human PSMD12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002816 Rosetta Predictions human pricing
NM_174871 Rosetta Predictions human pricing
NM_001005875 Rosetta Predictions rat pricing
NM_025894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088564 predicted 1015
2 SASI_Hs01_00088565 predicted 1260
3 SASI_Hs01_00088566 predicted 1052
4 SASI_Hs01_00088567 predicted 946
5 SASI_Hs02_00334503 predicted 641
6 SASI_Hs02_00334504 predicted 272
7 SASI_Hs02_00334505 predicted 258
8 SASI_Hs01_00088569 predicted 878
9 SASI_Hs02_00334506 predicted 433
10 SASI_Hs01_00088571 predicted 1302
11 SASI_Hs01_00088568 predicted 1293
12 SASI_Hs01_00088570 predicted 1297
13 SASI_Hs01_00088572 predicted 1317
14 SASI_Hs01_00088573 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082579 predicted 962
2 SASI_Hs01_00082580 predicted 1204
3 SASI_Hs01_00082581 predicted 1000
4 SASI_Hs01_00082582 predicted 892
5 SASI_Hs01_00082583 predicted 1230
6 SASI_Hs01_00082584 predicted 823
7 SASI_Hs01_00082585 predicted 1239
8 SASI_Hs01_00082586 predicted 1246
9 SASI_Hs01_00082587 predicted 1254
10 SASI_Hs01_00082588 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117798 predicted 725
2 SASI_Rn01_00117799 predicted 904
3 SASI_Rn01_00117800 predicted 240
4 SASI_Rn01_00117801 predicted 450
5 SASI_Rn01_00117802 predicted 846
6 SASI_Rn01_00117803 predicted 900
7 SASI_Rn01_00117805 predicted 250
8 SASI_Rn01_00117806 predicted 764
9 SASI_Rn02_00198448 predicted 1154
10 SASI_Rn02_00198449 predicted 676
11 SASI_Rn01_00117797 predicted 1259
12 SASI_Rn01_00117804 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102084 predicted 1143
2 SASI_Mm01_00102085 predicted 907
3 SASI_Mm01_00102086 predicted 716
4 SASI_Mm02_00329242 predicted 449
5 SASI_Mm02_00329243 predicted 239
6 SASI_Mm01_00102088 predicted 894
7 SASI_Mm01_00102090 predicted 790
8 SASI_Mm01_00102093 predicted 762
9 SASI_Mm02_00329244 predicted 1348
10 SASI_Mm02_00329245 predicted 1001
11 SASI_Mm01_00102087 predicted 1229
12 SASI_Mm01_00102089 predicted 1420
13 SASI_Mm01_00102091 predicted 1343
14 SASI_Mm01_00102092 predicted 1246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025894
VALIDATED
PSMD12 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1226s21c1
Sequence:CCGGCTCTCGAATCTAGTCGTTAACCTCGAGGTTAACGACTAGATTCGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-646s21c1
Sequence:CCGGCATTCGCACACAGATCATTAGCTCGAGCTAATGATCTGTGTGCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-711s21c1
Sequence:CCGGACTTGAAGTTGAAGTACTATACTCGAGTATAGTACTTCAACTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1150s21c1
Sequence:CCGGCAAGTACTACACTCGGATAACCTCGAGGTTATCCGAGTGTAGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025894.2-1479s21c1
Sequence:CCGGTTCATGGTGTATATGTTGTTTCTCGAGAAACAACATATACACCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025894.1-1573s1c1
Sequence:CCGGCCACTCTCTGATTTCATGATACTCGAGTATCATGAAATCAGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025894.1-937s1c1
Sequence:CCGGGCTGGAAGAAATTCCCAAATACTCGAGTATTTGGGAATTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-539s1c1
Sequence:CCGGGCCTCCATCCTTCAAGAGTTACTCGAGTAACTCTTGAAGGATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-1228s1c1
Sequence:CCGGCCTCTCGAATCTAGTCGTTAACTCGAGTTAACGACTAGATTCGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-436s1c1
Sequence:CCGGGCGGATGGTTACAGAAGGAAACTCGAGTTTCCTTCTGTAACCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025894
VALIDATED
PSMD12 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1226s21c1
Sequence:CCGGCTCTCGAATCTAGTCGTTAACCTCGAGGTTAACGACTAGATTCGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-646s21c1
Sequence:CCGGCATTCGCACACAGATCATTAGCTCGAGCTAATGATCTGTGTGCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-711s21c1
Sequence:CCGGACTTGAAGTTGAAGTACTATACTCGAGTATAGTACTTCAACTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1150s21c1
Sequence:CCGGCAAGTACTACACTCGGATAACCTCGAGGTTATCCGAGTGTAGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025894.2-1479s21c1
Sequence:CCGGTTCATGGTGTATATGTTGTTTCTCGAGAAACAACATATACACCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025894.1-1573s1c1
Sequence:CCGGCCACTCTCTGATTTCATGATACTCGAGTATCATGAAATCAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025894.1-937s1c1
Sequence:CCGGGCTGGAAGAAATTCCCAAATACTCGAGTATTTGGGAATTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-539s1c1
Sequence:CCGGGCCTCCATCCTTCAAGAGTTACTCGAGTAACTCTTGAAGGATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-1228s1c1
Sequence:CCGGCCTCTCGAATCTAGTCGTTAACTCGAGTTAACGACTAGATTCGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-436s1c1
Sequence:CCGGGCGGATGGTTACAGAAGGAAACTCGAGTTTCCTTCTGTAACCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025894
VALIDATED
PSMD12 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1226s21c1
Sequence:CCGGCTCTCGAATCTAGTCGTTAACCTCGAGGTTAACGACTAGATTCGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-646s21c1
Sequence:CCGGCATTCGCACACAGATCATTAGCTCGAGCTAATGATCTGTGTGCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-711s21c1
Sequence:CCGGACTTGAAGTTGAAGTACTATACTCGAGTATAGTACTTCAACTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025894.2-1150s21c1
Sequence:CCGGCAAGTACTACACTCGGATAACCTCGAGGTTATCCGAGTGTAGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025894.2-1479s21c1
Sequence:CCGGTTCATGGTGTATATGTTGTTTCTCGAGAAACAACATATACACCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025894.1-1573s1c1
Sequence:CCGGCCACTCTCTGATTTCATGATACTCGAGTATCATGAAATCAGAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025894.1-937s1c1
Sequence:CCGGGCTGGAAGAAATTCCCAAATACTCGAGTATTTGGGAATTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-539s1c1
Sequence:CCGGGCCTCCATCCTTCAAGAGTTACTCGAGTAACTCTTGAAGGATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-1228s1c1
Sequence:CCGGCCTCTCGAATCTAGTCGTTAACTCGAGTTAACGACTAGATTCGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025894.1-436s1c1
Sequence:CCGGGCGGATGGTTACAGAAGGAAACTCGAGTTTCCTTCTGTAACCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174871
VALIDATED
PSMD12 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-208s21c1
Sequence:CCGGTATCGACATCCCGTATCTTAGCTCGAGCTAAGATACGGGATGTCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-377s21c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1242s21c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1447s21c1
Sequence:CCGGGACTGTTATAATGGTGTATATCTCGAGATATACACCATTATAACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-1125s1c1
Sequence:CCGGGCCAAGTATTATACTCGGATACTCGAGTATCCGAGTATAATACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-1242s1c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-377s1c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-890s1c1
Sequence:CCGGCCGAATAAGTGGTGACAAGAACTCGAGTTCTTGTCACCACTTATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-605s1c1
Sequence:CCGGCCTAGCTGTGAAGGATTACATCTCGAGATGTAATCCTTCACAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174871
VALIDATED
PSMD12 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-208s21c1
Sequence:CCGGTATCGACATCCCGTATCTTAGCTCGAGCTAAGATACGGGATGTCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-377s21c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1242s21c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1447s21c1
Sequence:CCGGGACTGTTATAATGGTGTATATCTCGAGATATACACCATTATAACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-1125s1c1
Sequence:CCGGGCCAAGTATTATACTCGGATACTCGAGTATCCGAGTATAATACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-1242s1c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-377s1c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-890s1c1
Sequence:CCGGCCGAATAAGTGGTGACAAGAACTCGAGTTCTTGTCACCACTTATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-605s1c1
Sequence:CCGGCCTAGCTGTGAAGGATTACATCTCGAGATGTAATCCTTCACAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174871
VALIDATED
PSMD12 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-208s21c1
Sequence:CCGGTATCGACATCCCGTATCTTAGCTCGAGCTAAGATACGGGATGTCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-377s21c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1242s21c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_174871.2-1447s21c1
Sequence:CCGGGACTGTTATAATGGTGTATATCTCGAGATATACACCATTATAACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-1125s1c1
Sequence:CCGGGCCAAGTATTATACTCGGATACTCGAGTATCCGAGTATAATACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-1242s1c1
Sequence:CCGGGTAGACAGATTAGCAGGAATTCTCGAGAATTCCTGCTAATCTGTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174871.1-377s1c1
Sequence:CCGGCCTTCCTATCAAACTTCGATTCTCGAGAATCGAAGTTTGATAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-890s1c1
Sequence:CCGGCCGAATAAGTGGTGACAAGAACTCGAGTTCTTGTCACCACTTATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174871.1-605s1c1
Sequence:CCGGCCTAGCTGTGAAGGATTACATCTCGAGATGTAATCCTTCACAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)