EMAIL THIS PAGE TO A FRIEND

PSMD13

proteasome (prosome, macropain) 26S subunit, non-ATPase, 13

59 Gene Product Result for
Synonyms: HSPC027 Rpn9 S11 p40.5
UniProtKB ID: Q9UNM6, B3KT15, O75831, Q53XU2, Q9UNV3
Gene ID:
Human(5719) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(23997) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Rat(365388) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Zebrafish(393922) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
domestic cat(101101591) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Horse(100050948) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
dog(475934) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
chicken(422990) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
cow(513525) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
sheep(101104945) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
naked mole-rat(101698107) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
domestic guinea pig(100714436) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002817 Rosetta Predictions human pricing
NM_175932 Rosetta Predictions human pricing
NM_001108925 Rosetta Predictions rat pricing
NM_011875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010081 predicted 1011
2 SASI_Hs01_00010082 predicted 735
3 SASI_Hs01_00010084 predicted 1414
4 SASI_Hs01_00010086 predicted 1436
5 SASI_Hs01_00010087 predicted 665
6 SASI_Hs01_00010088 predicted 671
7 SASI_Hs01_00010089 predicted 1089
8 SASI_Hs01_00010090 predicted 1430
9 SASI_Hs02_00334507 predicted 849
10 SASI_Hs02_00334508 predicted 951
11 SASI_Hs01_00010083 predicted 1334
12 SASI_Hs01_00010085 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229025 predicted 1017
2 SASI_Hs01_00229026 predicted 744
3 SASI_Hs01_00229028 predicted 1416
4 SASI_Hs01_00229030 predicted 1444
5 SASI_Hs01_00229031 predicted 675
6 SASI_Hs01_00229032 predicted 677
7 SASI_Hs01_00229033 predicted 1099
8 SASI_Hs01_00229034 predicted 1434
9 SASI_Hs02_00369190 predicted 854
10 SASI_Hs02_00369191 predicted 964
11 SASI_Hs01_00229027 predicted 1410
12 SASI_Hs01_00229029 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243434 predicted 520
2 SASI_Rn02_00243435 predicted 840
3 SASI_Rn02_00243436 predicted 415
4 SASI_Rn02_00243437 predicted 285
5 SASI_Rn02_00243438 predicted 333
6 SASI_Rn02_00243439 predicted 238
7 SASI_Rn02_00243440 predicted 1218
8 SASI_Rn02_00243441 predicted 1131
9 SASI_Rn02_00243442 predicted 368
10 SASI_Rn02_00243443 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040894 predicted 1269
2 SASI_Mm01_00040895 predicted 478
3 SASI_Mm01_00040896 predicted 342
4 SASI_Mm01_00040897 predicted 572
5 SASI_Mm01_00040898 predicted 901
6 SASI_Mm01_00040899 predicted 346
7 SASI_Mm01_00040900 predicted 596
8 SASI_Mm01_00040901 predicted 327
9 SASI_Mm01_00040902 predicted 338
10 SASI_Mm01_00040903 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011875
VALIDATED
PSMD13 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1323s21c1
Sequence:CCGGTGGGAACTGTTCTTGCTATAACTCGAGTTATAGCAAGAACAGTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-423s21c1
Sequence:CCGGGACGGCAATCGGAGCTCTAAACTCGAGTTTAGAGCTCCGATTGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1098s21c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-539s21c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-463s1c1
Sequence:CCGGGCAGGCTACAAAGGAAACCATCTCGAGATGGTTTCCTTTGTAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-342s1c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-1099s1c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-540s1c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011875.2-782s1c1
Sequence:CCGGGACACCCTGTACGCTTTCAATCTCGAGATTGAAAGCGTACAGGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-341s21c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011875
VALIDATED
PSMD13 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1323s21c1
Sequence:CCGGTGGGAACTGTTCTTGCTATAACTCGAGTTATAGCAAGAACAGTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-423s21c1
Sequence:CCGGGACGGCAATCGGAGCTCTAAACTCGAGTTTAGAGCTCCGATTGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1098s21c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-539s21c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-463s1c1
Sequence:CCGGGCAGGCTACAAAGGAAACCATCTCGAGATGGTTTCCTTTGTAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-342s1c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-1099s1c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-540s1c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011875.2-782s1c1
Sequence:CCGGGACACCCTGTACGCTTTCAATCTCGAGATTGAAAGCGTACAGGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-341s21c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011875
VALIDATED
PSMD13 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1323s21c1
Sequence:CCGGTGGGAACTGTTCTTGCTATAACTCGAGTTATAGCAAGAACAGTTCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-423s21c1
Sequence:CCGGGACGGCAATCGGAGCTCTAAACTCGAGTTTAGAGCTCCGATTGCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-1098s21c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-539s21c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-463s1c1
Sequence:CCGGGCAGGCTACAAAGGAAACCATCTCGAGATGGTTTCCTTTGTAGCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-342s1c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-1099s1c1
Sequence:CCGGGCTGGATTTGCAGCAGATCAACTCGAGTTGATCTGCTGCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011875.2-540s1c1
Sequence:CCGGGTTTCTATGATCTCTCCAGTACTCGAGTACTGGAGAGATCATAGAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011875.2-782s1c1
Sequence:CCGGGACACCCTGTACGCTTTCAATCTCGAGATTGAAAGCGTACAGGGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011875.4-341s21c1
Sequence:CCGGCCGATCCTAATGTGGCTCTTACTCGAGTAAGAGCCACATTAGGATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002817
VALIDATED
PSMD13 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002817.3-458s21c1
Sequence:CCGGCCCTTTGTCCCTCGTGGAAATCTCGAGATTTCCACGAGGGACAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-353s21c1
Sequence:CCGGGACACTTCAGGTGCTTGATTTCTCGAGAAATCAAGCACCTGAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-707s21c1
Sequence:CCGGCTATGATCTCTCCAGTAAATACTCGAGTATTTACTGGAGAGATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-225s1c1
Sequence:CCGGCCCAAGGAGATGGTCTCATTACTCGAGTAATGAGACCATCTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-458s1c1
Sequence:CCGGCAGGTTACAAAGGAAACAATTCTCGAGAATTGTTTCCTTTGTAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-844s1c1
Sequence:CCGGGCAGCCTGATTTAGCAGCTAACTCGAGTTAGCTGCTAAATCAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-767s1c1
Sequence:CCGGTGGCTGATTGACACCCTCTATCTCGAGATAGAGGGTGTCAATCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-305s1c1
Sequence:CCGGGAAATCATTCTTCACGTAGTTCTCGAGAACTACGTGAAGAATGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-401s21c1
Sequence:CCGGAGATGGTCTCATTAAGCTTTACTCGAGTAAAGCTTAATGAGACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-1448s21c1
Sequence:CCGGCAGACGGTCGACATTGAATTTCTCGAGAAATTCAATGTCGACCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002817
VALIDATED
PSMD13 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002817.3-458s21c1
Sequence:CCGGCCCTTTGTCCCTCGTGGAAATCTCGAGATTTCCACGAGGGACAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-353s21c1
Sequence:CCGGGACACTTCAGGTGCTTGATTTCTCGAGAAATCAAGCACCTGAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-707s21c1
Sequence:CCGGCTATGATCTCTCCAGTAAATACTCGAGTATTTACTGGAGAGATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-225s1c1
Sequence:CCGGCCCAAGGAGATGGTCTCATTACTCGAGTAATGAGACCATCTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-458s1c1
Sequence:CCGGCAGGTTACAAAGGAAACAATTCTCGAGAATTGTTTCCTTTGTAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-844s1c1
Sequence:CCGGGCAGCCTGATTTAGCAGCTAACTCGAGTTAGCTGCTAAATCAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-767s1c1
Sequence:CCGGTGGCTGATTGACACCCTCTATCTCGAGATAGAGGGTGTCAATCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-305s1c1
Sequence:CCGGGAAATCATTCTTCACGTAGTTCTCGAGAACTACGTGAAGAATGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-401s21c1
Sequence:CCGGAGATGGTCTCATTAAGCTTTACTCGAGTAAAGCTTAATGAGACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-1448s21c1
Sequence:CCGGCAGACGGTCGACATTGAATTTCTCGAGAAATTCAATGTCGACCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002817
VALIDATED
PSMD13 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002817.3-458s21c1
Sequence:CCGGCCCTTTGTCCCTCGTGGAAATCTCGAGATTTCCACGAGGGACAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-353s21c1
Sequence:CCGGGACACTTCAGGTGCTTGATTTCTCGAGAAATCAAGCACCTGAAGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-707s21c1
Sequence:CCGGCTATGATCTCTCCAGTAAATACTCGAGTATTTACTGGAGAGATCATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-225s1c1
Sequence:CCGGCCCAAGGAGATGGTCTCATTACTCGAGTAATGAGACCATCTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-458s1c1
Sequence:CCGGCAGGTTACAAAGGAAACAATTCTCGAGAATTGTTTCCTTTGTAACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-844s1c1
Sequence:CCGGGCAGCCTGATTTAGCAGCTAACTCGAGTTAGCTGCTAAATCAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002817.2-767s1c1
Sequence:CCGGTGGCTGATTGACACCCTCTATCTCGAGATAGAGGGTGTCAATCAGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002817.2-305s1c1
Sequence:CCGGGAAATCATTCTTCACGTAGTTCTCGAGAACTACGTGAAGAATGATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-401s21c1
Sequence:CCGGAGATGGTCTCATTAAGCTTTACTCGAGTAAAGCTTAATGAGACCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002817.3-1448s21c1
Sequence:CCGGCAGACGGTCGACATTGAATTTCTCGAGAAATTCAATGTCGACCGTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)