EMAIL THIS PAGE TO A FRIEND

PSMD14

proteasome (prosome, macropain) 26S subunit, non-ATPase, 14

68 Gene Product Result for
Synonyms: PAD1 POH1 RPN11
UniProtKB ID: O00487, B3KNW2, O00176
Gene ID:
Human(10213) Summary: This gene encodes a component of the 26S proteasome. The 26S proteasome is a large multiprotein complex that catalyzes the degradation of ubiquitinated intracellular proteins. The encoded protein is a component of the 19S regulatory cap complex of the 26S proteasome and mediates substrate deubiquitination. A pseudogene of this gene is also located on the long arm of chromosome 2. [provided by RefSeq, Feb 2012]
Mouse(59029) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Rat(311078) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
domestic guinea pig(100721655) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
naked mole-rat(101697286) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
cow(535683) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
sheep(101108368) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Zebrafish(799058) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Horse(100051409) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
domestic cat(101095118) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
dog(478765) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
chicken(424189) proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005805 Rosetta Predictions human pricing
NM_001025689 Rosetta Predictions rat pricing
XM_001054967 Rosetta Predictions rat pricing
XM_001059730 Rosetta Predictions rat pricing
NM_021526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340316 predicted 813
2 SASI_Hs01_00024446 predicted 508
3 SASI_Hs01_00024447 predicted 948
4 SASI_Hs01_00024448 predicted 1007
5 SASI_Hs01_00024449 predicted 460
6 SASI_Hs01_00024450 predicted 982
7 SASI_Hs01_00024451 predicted 790
8 SASI_Hs01_00024453 predicted 886
9 SASI_Hs01_00024454 predicted 841
10 SASI_Hs01_00024455 predicted 870
11 SASI_Hs01_00024452 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203297 predicted 916
2 SASI_Rn02_00203298 predicted 480
3 SASI_Rn02_00203299 predicted 764
4 SASI_Rn02_00203300 predicted 1021
5 SASI_Rn02_00203301 predicted 1142
6 SASI_Rn02_00203302 predicted 422
7 SASI_Rn02_00203303 predicted 437
8 SASI_Rn02_00203304 predicted 1169
9 SASI_Rn02_00203305 predicted 720
10 SASI_Rn02_00203306 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277862 predicted 677
2 SASI_Rn02_00277863 predicted 244
3 SASI_Rn02_00277864 predicted 518
4 SASI_Rn02_00277865 predicted 779
5 SASI_Rn02_00277866 predicted 901
6 SASI_Rn02_00277867 predicted 197
7 SASI_Rn02_00277868 predicted 930
8 SASI_Rn02_00277869 predicted 486
9 SASI_Rn02_00277870 predicted 788
10 SASI_Rn02_00277871 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294141 predicted 868
2 SASI_Rn02_00294142 predicted 718
3 SASI_Rn02_00294143 predicted 983
4 SASI_Rn02_00294144 predicted 1100
5 SASI_Rn02_00294145 predicted 1122
6 SASI_Rn02_00294146 predicted 685
7 SASI_Rn02_00294147 predicted 935
8 SASI_Rn02_00294148 predicted 990
9 SASI_Rn02_00294149 predicted 775
10 SASI_Rn02_00294150 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031313 predicted 886
2 SASI_Mm01_00031314 predicted 985
3 SASI_Mm01_00031315 predicted 840
4 SASI_Mm01_00031316 predicted 943
5 SASI_Mm01_00031317 predicted 1052
6 SASI_Mm01_00031318 predicted 789
7 SASI_Mm01_00031319 predicted 1177
8 SASI_Mm01_00031320 predicted 916
9 SASI_Mm01_00031321 predicted 852
10 SASI_Mm01_00031322 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021526
VALIDATED
PSMD14 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-858s21c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-382s1c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-461s21c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-815s1c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-1134s1c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-431s1c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-779s1c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-894s21c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-1213s21c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-510s21c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021526
VALIDATED
PSMD14 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-858s21c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-382s1c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-461s21c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-815s1c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-1134s1c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-431s1c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-779s1c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-894s21c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-1213s21c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-510s21c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021526
VALIDATED
PSMD14 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-858s21c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-382s1c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-461s21c1
Sequence:CCGGCTATGGAAGTTATGGGTCTAACTCGAGTTAGACCCATAACTTCCATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-815s1c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-1134s1c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-431s1c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021526.1-779s1c1
Sequence:CCGGCCACTTAAACAAGCCATCTATCTCGAGATAGATGGCTTGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-894s21c1
Sequence:CCGGCGGACTAAACAGACATTATTACTCGAGTAATAATGTCTGTTTAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-1213s21c1
Sequence:CCGGGCCGCAATGTTGGATACTGTTCTCGAGAACAGTATCCAACATTGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021526.2-510s21c1
Sequence:CCGGCGTCAGAGTGATTGATGTGTTCTCGAGAACACATCAATCACTCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005805
VALIDATED
PSMD14 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005805.3-846s21c1
Sequence:CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005805.1-558s1c1
Sequence:CCGGGTTGGCTTTCTGGTGTGGATACTCGAGTATCCACACCAGAAAGCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-754s1c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-868s21c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-1064s21c1
Sequence:CCGGTTAGCCAAGAATTACAATAAGCTCGAGCTTATTGTAATTCTTGGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-779s1c1
Sequence:CCGGCATGGACTAAACAGACATTATCTCGAGATAATGTCTGTTTAGTCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-901s1c1
Sequence:CCGGCAGTGAACATTGTAAACACAACTCGAGTTGTGTTTACAATGTTCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-392s21c1
Sequence:CCGGACAGCAGAACAAGTCTATATCCTCGAGGATATAGACTTGTTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-793s21c1
Sequence:CCGGCAGATTGATCAATGCTAATATCTCGAGATATTAGCATTGATCAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005805
VALIDATED
PSMD14 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005805.3-846s21c1
Sequence:CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005805.1-558s1c1
Sequence:CCGGGTTGGCTTTCTGGTGTGGATACTCGAGTATCCACACCAGAAAGCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-754s1c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-868s21c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-1064s21c1
Sequence:CCGGTTAGCCAAGAATTACAATAAGCTCGAGCTTATTGTAATTCTTGGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-779s1c1
Sequence:CCGGCATGGACTAAACAGACATTATCTCGAGATAATGTCTGTTTAGTCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-901s1c1
Sequence:CCGGCAGTGAACATTGTAAACACAACTCGAGTTGTGTTTACAATGTTCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-392s21c1
Sequence:CCGGACAGCAGAACAAGTCTATATCCTCGAGGATATAGACTTGTTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-793s21c1
Sequence:CCGGCAGATTGATCAATGCTAATATCTCGAGATATTAGCATTGATCAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005805
VALIDATED
PSMD14 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005805.3-846s21c1
Sequence:CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005805.1-558s1c1
Sequence:CCGGGTTGGCTTTCTGGTGTGGATACTCGAGTATCCACACCAGAAAGCCAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-754s1c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-868s21c1
Sequence:CCGGCAAGCCATCTATCCAGGCATTCTCGAGAATGCCTGGATAGATGGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-1064s21c1
Sequence:CCGGTTAGCCAAGAATTACAATAAGCTCGAGCTTATTGTAATTCTTGGCTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-779s1c1
Sequence:CCGGCATGGACTAAACAGACATTATCTCGAGATAATGTCTGTTTAGTCCATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005805.1-901s1c1
Sequence:CCGGCAGTGAACATTGTAAACACAACTCGAGTTGTGTTTACAATGTTCACTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-392s21c1
Sequence:CCGGACAGCAGAACAAGTCTATATCCTCGAGGATATAGACTTGTTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005805.3-793s21c1
Sequence:CCGGCAGATTGATCAATGCTAATATCTCGAGATATTAGCATTGATCAATCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)