EMAIL THIS PAGE TO A FRIEND

PSMD1

proteasome (prosome, macropain) 26S subunit, non-ATPase, 1

52 Gene Product Result for
Synonyms: P112 Rpn2 S1
Gene ID:
Human(5707) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes the largest non-ATPase subunit of the 19S regulator lid, which is responsible for substrate recognition and binding. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2010]
Mouse(70247) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Rat(83806) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Zebrafish(554967) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Horse(100057015) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
dog(100683530) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
chicken(424926) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
cow(511803) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
sheep(101122259) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
naked mole-rat(101699553) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
domestic guinea pig(100736234) proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002807 Rosetta Predictions human pricing
NM_031978 Rosetta Predictions rat pricing
NM_027357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231982 predicted 775
2 SASI_Hs01_00231983 predicted 1229
3 SASI_Hs01_00231984 predicted 2186
4 SASI_Hs02_00334484 predicted 813
5 SASI_Hs01_00231986 predicted 1938
6 SASI_Hs01_00231988 predicted 2223
7 SASI_Hs01_00231989 predicted 1675
8 SASI_Hs01_00231990 predicted 1873
9 SASI_Hs01_00231991 predicted 1750
10 SASI_Hs02_00334485 predicted 2276
11 SASI_Hs01_00231985 predicted 1941
12 SASI_Hs01_00231987 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061104 predicted 1058
2 SASI_Rn01_00061105 predicted 1361
3 SASI_Rn01_00061106 predicted 1839
4 SASI_Rn02_00265375 predicted 1782
5 SASI_Rn01_00061107 predicted 1754
6 SASI_Rn01_00061108 predicted 1798
7 SASI_Rn01_00061109 predicted 688
8 SASI_Rn01_00061110 predicted 1661
9 SASI_Rn01_00061111 predicted 1735
10 SASI_Rn02_00265376 predicted 1095
11 SASI_Rn01_00061102 predicted 1542
12 SASI_Rn01_00061103 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128308 predicted 810
2 SASI_Mm01_00128309 predicted 1572
3 SASI_Mm01_00128310 predicted 547
4 SASI_Mm01_00128311 predicted 1968
5 SASI_Mm01_00128312 predicted 1226
6 SASI_Mm02_00332031 predicted 1717
7 SASI_Mm01_00128313 predicted 1499
8 SASI_Mm02_00332032 predicted 2227
9 SASI_Mm01_00128314 predicted 1322
10 SASI_Mm01_00128315 predicted 1931
11 SASI_Mm01_00128316 predicted 710
12 SASI_Mm01_00128317 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002807
VALIDATED
PSMD1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-309s21c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1596s21c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1947s21c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-309s1c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002807.2-1947s1c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2963s1c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-1596s1c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2860s1c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002807.2-2860s21c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-2963s21c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002807
VALIDATED
PSMD1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-309s21c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1596s21c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1947s21c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-309s1c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002807.2-1947s1c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2963s1c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-1596s1c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2860s1c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002807.2-2860s21c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-2963s21c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002807
VALIDATED
PSMD1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-309s21c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1596s21c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-1947s21c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-309s1c1
Sequence:CCGGGCAGCCTTAGTGGCATCTAAACTCGAGTTTAGATGCCACTAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002807.2-1947s1c1
Sequence:CCGGGCTGTAAGTGATGTTAATGATCTCGAGATCATTAACATCACTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2963s1c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-1596s1c1
Sequence:CCGGGCACGTCAAGATGTTTATGATCTCGAGATCATAAACATCTTGACGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002807.2-2860s1c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002807.2-2860s21c1
Sequence:CCGGGCATCATCATTCTGAAGGATACTCGAGTATCCTTCAGAATGATGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002807.2-2963s21c1
Sequence:CCGGCCCAGAACCATTTGAGTATATCTCGAGATATACTCAAATGGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027357
VALIDATED
PSMD1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-594s21c1
Sequence:CCGGTCTCGATGATCACAAGTATAACTCGAGTTATACTTGTGATCATCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1566s1c1
Sequence:CCGGCAAGAATGCCAGCAATGATATCTCGAGATATCATTGCTGGCATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-454s1c1
Sequence:CCGGGAATATGTGGAGACTATTATACTCGAGTATAATAGTCTCCACATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1188s1c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-453s21c1
Sequence:CCGGTGAATATGTGGAGACTATTATCTCGAGATAATAGTCTCCACATATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-3068s21c1
Sequence:CCGGTGTCCTGGCGCACACTGAAATCTCGAGATTTCAGTGTGCGCCAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-1188s21c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-2805s21c1
Sequence:CCGGGGATAATCCAGCACGAGTTATCTCGAGATAACTCGTGCTGGATTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.1-1321s1c1
Sequence:CCGGCCAGTTTCTTAGAGATAACTTCTCGAGAAGTTATCTCTAAGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027357
VALIDATED
PSMD1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-594s21c1
Sequence:CCGGTCTCGATGATCACAAGTATAACTCGAGTTATACTTGTGATCATCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1566s1c1
Sequence:CCGGCAAGAATGCCAGCAATGATATCTCGAGATATCATTGCTGGCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-454s1c1
Sequence:CCGGGAATATGTGGAGACTATTATACTCGAGTATAATAGTCTCCACATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1188s1c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-453s21c1
Sequence:CCGGTGAATATGTGGAGACTATTATCTCGAGATAATAGTCTCCACATATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-3068s21c1
Sequence:CCGGTGTCCTGGCGCACACTGAAATCTCGAGATTTCAGTGTGCGCCAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-1188s21c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-2805s21c1
Sequence:CCGGGGATAATCCAGCACGAGTTATCTCGAGATAACTCGTGCTGGATTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.1-1321s1c1
Sequence:CCGGCCAGTTTCTTAGAGATAACTTCTCGAGAAGTTATCTCTAAGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027357
VALIDATED
PSMD1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-594s21c1
Sequence:CCGGTCTCGATGATCACAAGTATAACTCGAGTTATACTTGTGATCATCGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1566s1c1
Sequence:CCGGCAAGAATGCCAGCAATGATATCTCGAGATATCATTGCTGGCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-454s1c1
Sequence:CCGGGAATATGTGGAGACTATTATACTCGAGTATAATAGTCTCCACATATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.2-1188s1c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-453s21c1
Sequence:CCGGTGAATATGTGGAGACTATTATCTCGAGATAATAGTCTCCACATATTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-3068s21c1
Sequence:CCGGTGTCCTGGCGCACACTGAAATCTCGAGATTTCAGTGTGCGCCAGGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027357.2-1188s21c1
Sequence:CCGGGCAGTTCCTAATACGAAATAACTCGAGTTATTTCGTATTAGGAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027357.2-2805s21c1
Sequence:CCGGGGATAATCCAGCACGAGTTATCTCGAGATAACTCGTGCTGGATTATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027357.1-1321s1c1
Sequence:CCGGCCAGTTTCTTAGAGATAACTTCTCGAGAAGTTATCTCTAAGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)