EMAIL THIS PAGE TO A FRIEND

PSMD2

proteasome (prosome, macropain) 26S subunit, non-ATPase, 2

62 Gene Product Result for
Synonyms: P97 RPN1 S2 TRAP2
UniProtKB ID: Q13200, Q12932, Q15321, Q53XQ4, Q96I12
Gene ID:
Human(5708) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(21762) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Rat(287984) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Zebrafish(393518) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
chicken(425294) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
dog(478654) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Horse(100059081) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
domestic cat(101095190) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
cow(539784) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
sheep(101120791) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
naked mole-rat(101711698) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
domestic guinea pig(100725505) proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002808 Rosetta Predictions human pricing
NM_001031639 Rosetta Predictions rat pricing
NM_134101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042153 predicted 1508
2 SASI_Hs01_00042154 predicted 1195
3 SASI_Hs01_00042155 predicted 1467
4 SASI_Hs02_00334486 predicted 2427
5 SASI_Hs02_00334487 predicted 2190
6 SASI_Hs01_00042157 predicted 2168
7 SASI_Hs02_00334488 predicted 1533
8 SASI_Hs02_00334489 predicted 2436
9 SASI_Hs01_00042159 predicted 491
10 SASI_Hs02_00334490 predicted 1486
11 SASI_Hs01_00042152 predicted 339
12 SASI_Hs01_00042156 predicted 271
13 SASI_Hs01_00042158 predicted 844
14 SASI_Hs01_00042160 predicted 842
15 SASI_Hs01_00042161 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088639 predicted 243
2 SASI_Rn01_00088640 predicted 304
3 SASI_Rn01_00088641 predicted 1247
4 SASI_Rn01_00088642 predicted 932
5 SASI_Rn01_00088643 predicted 461
6 SASI_Rn01_00088644 predicted 818
7 SASI_Rn01_00088645 predicted 547
8 SASI_Rn01_00088647 predicted 1442
9 SASI_Rn02_00203569 predicted 1504
10 SASI_Rn02_00203570 predicted 475
11 SASI_Rn01_00088638 predicted 1185
12 SASI_Rn01_00088646 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042742 predicted 671
2 SASI_Mm01_00042743 predicted 1652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002808
VALIDATED
PSMD2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1501s21c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-175s21c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-2452s21c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1872s21c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-175s1c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1501s1c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-2452s1c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002808.3-610s1c1
Sequence:CCGGCCCTATAACATGGCCCACAATCTCGAGATTGTGGGCCATGTTATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1872s1c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002808
VALIDATED
PSMD2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1501s21c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-175s21c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-2452s21c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1872s21c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-175s1c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1501s1c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-2452s1c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002808.3-610s1c1
Sequence:CCGGCCCTATAACATGGCCCACAATCTCGAGATTGTGGGCCATGTTATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1872s1c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002808
VALIDATED
PSMD2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1501s21c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-175s21c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-2452s21c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002808.3-1872s21c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-175s1c1
Sequence:CCGGGAGGATAAACAGCTTCAAGATCTCGAGATCTTGAAGCTGTTTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1501s1c1
Sequence:CCGGGCTGGCTCAAATCGTGAAGATCTCGAGATCTTCACGATTTGAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-2452s1c1
Sequence:CCGGCGAAACATTATTCTAGGCAAACTCGAGTTTGCCTAGAATAATGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002808.3-610s1c1
Sequence:CCGGCCCTATAACATGGCCCACAATCTCGAGATTGTGGGCCATGTTATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002808.3-1872s1c1
Sequence:CCGGCCACATTTGTAGCGAACACTTCTCGAGAAGTGTTCGCTACAAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134101
VALIDATED
PSMD2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2270s1c1
Sequence:CCGGCGCCAGTTAGCTCAATATCATCTCGAGATGATATTGAGCTAACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-611s1c1
Sequence:CCGGCCCTACAACATGGCTCACAATCTCGAGATTGTGAGCCATGTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134101.1-2513s1c1
Sequence:CCGGCCTCGGATGCTGGTTACATTTCTCGAGAAATGTAACCAGCATCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-331s1c1
Sequence:CCGGGCGTCCACACTATGGCAAATTCTCGAGAATTTGCCATAGTGTGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2709s1c1
Sequence:CCGGCCATTCTGGAAGGCTTTGTTACTCGAGTAACAAAGCCTTCCAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134101
VALIDATED
PSMD2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2270s1c1
Sequence:CCGGCGCCAGTTAGCTCAATATCATCTCGAGATGATATTGAGCTAACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-611s1c1
Sequence:CCGGCCCTACAACATGGCTCACAATCTCGAGATTGTGAGCCATGTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134101.1-2513s1c1
Sequence:CCGGCCTCGGATGCTGGTTACATTTCTCGAGAAATGTAACCAGCATCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-331s1c1
Sequence:CCGGGCGTCCACACTATGGCAAATTCTCGAGAATTTGCCATAGTGTGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2709s1c1
Sequence:CCGGCCATTCTGGAAGGCTTTGTTACTCGAGTAACAAAGCCTTCCAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134101
VALIDATED
PSMD2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2270s1c1
Sequence:CCGGCGCCAGTTAGCTCAATATCATCTCGAGATGATATTGAGCTAACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-611s1c1
Sequence:CCGGCCCTACAACATGGCTCACAATCTCGAGATTGTGAGCCATGTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134101.1-2513s1c1
Sequence:CCGGCCTCGGATGCTGGTTACATTTCTCGAGAAATGTAACCAGCATCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-331s1c1
Sequence:CCGGGCGTCCACACTATGGCAAATTCTCGAGAATTTGCCATAGTGTGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134101.1-2709s1c1
Sequence:CCGGCCATTCTGGAAGGCTTTGTTACTCGAGTAACAAAGCCTTCCAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)