EMAIL THIS PAGE TO A FRIEND

PSMD3

proteasome (prosome, macropain) 26S subunit, non-ATPase, 3

73 Gene Product Result for
Synonyms: P58 RPN3 S3 TSTA2
UniProtKB ID: O43242, B3KMW9, Q96EI2, Q9BQA4
Gene ID:
Human(5709) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Mouse(22123) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Rat(287670) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Zebrafish(393544) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
chicken(426133) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
dog(491018) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
domestic cat(101094305) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
domestic guinea pig(100725725) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
naked mole-rat(101700231) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
cow(504937) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
sheep(101105833) proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002809 Rosetta Predictions human pricing
NM_001008281 Rosetta Predictions rat pricing
NM_009439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195946 predicted 810
2 SASI_Hs01_00195947 predicted 941
3 SASI_Hs01_00195948 predicted 1538
4 SASI_Hs01_00195949 predicted 1230
5 SASI_Hs01_00195950 predicted 961
6 SASI_Hs01_00195951 predicted 522
7 SASI_Hs01_00195952 predicted 732
8 SASI_Hs01_00195953 predicted 1488
9 SASI_Hs01_00195954 predicted 486
10 SASI_Hs01_00195955 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106904 predicted 1348
2 SASI_Rn01_00106905 predicted 1426
3 SASI_Rn01_00106906 predicted 661
4 SASI_Rn01_00106907 predicted 1463
5 SASI_Rn01_00106908 predicted 909
6 SASI_Rn01_00106909 predicted 1008
7 SASI_Rn01_00106910 predicted 1095
8 SASI_Rn01_00106911 predicted 495
9 SASI_Rn01_00106912 predicted 506
10 SASI_Rn02_00198980 predicted 1351
11 SASI_Rn01_00106913 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110977 predicted 1455
2 SASI_Mm01_00110978 predicted 1381
3 SASI_Mm01_00110979 predicted 596
4 SASI_Mm01_00110980 predicted 696
5 SASI_Mm01_00110981 predicted 1230
6 SASI_Mm01_00110982 predicted 1538
7 SASI_Mm01_00110983 predicted 591
8 SASI_Mm01_00110984 predicted 962
9 SASI_Mm01_00110985 predicted 1130
10 SASI_Mm01_00110986 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009439
VALIDATED
PSMD3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1535s1c1
Sequence:CCGGCGTCCAATCCAAAGAGATGATCTCGAGATCATCTCTTTGGATTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1028s1c1
Sequence:CCGGCCTCTATTACACAGGGCGAATCTCGAGATTCGCCCTGTGTAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009439.1-485s1c1
Sequence:CCGGCCTCAACCACTATGTTCTGTACTCGAGTACAGAACATAGTGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-702s1c1
Sequence:CCGGCGCTACAAAGAGGCACAGAAACTCGAGTTTCTGTGCCTCTTTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-926s1c1
Sequence:CCGGGCTTCGGAATTACCTGCACTACTCGAGTAGTGCAGGTAATTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009439
VALIDATED
PSMD3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1535s1c1
Sequence:CCGGCGTCCAATCCAAAGAGATGATCTCGAGATCATCTCTTTGGATTGGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1028s1c1
Sequence:CCGGCCTCTATTACACAGGGCGAATCTCGAGATTCGCCCTGTGTAATAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009439.1-485s1c1
Sequence:CCGGCCTCAACCACTATGTTCTGTACTCGAGTACAGAACATAGTGGTTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-702s1c1
Sequence:CCGGCGCTACAAAGAGGCACAGAAACTCGAGTTTCTGTGCCTCTTTGTAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-926s1c1
Sequence:CCGGGCTTCGGAATTACCTGCACTACTCGAGTAGTGCAGGTAATTCCGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009439
VALIDATED
PSMD3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000066122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1535s1c1
Sequence:CCGGCGTCCAATCCAAAGAGATGATCTCGAGATCATCTCTTTGGATTGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-1028s1c1
Sequence:CCGGCCTCTATTACACAGGGCGAATCTCGAGATTCGCCCTGTGTAATAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009439.1-485s1c1
Sequence:CCGGCCTCAACCACTATGTTCTGTACTCGAGTACAGAACATAGTGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-702s1c1
Sequence:CCGGCGCTACAAAGAGGCACAGAAACTCGAGTTTCTGTGCCTCTTTGTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009439.1-926s1c1
Sequence:CCGGGCTTCGGAATTACCTGCACTACTCGAGTAGTGCAGGTAATTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002809
VALIDATED
PSMD3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1239s1c1
Sequence:CCGGCCCTATTTCCTTCTGACTCAACTCGAGTTGAGTCAGAAGGAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1642s1c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-783s1c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-926s1c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002809.2-515s1c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-515s21c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1642s21c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1853s21c1
Sequence:CCGGTTTCCCACACACAGCTCATATCTCGAGATATGAGCTGTGTGTGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-926s21c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-783s21c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002809
VALIDATED
PSMD3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1239s1c1
Sequence:CCGGCCCTATTTCCTTCTGACTCAACTCGAGTTGAGTCAGAAGGAAATAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1642s1c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-783s1c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-926s1c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002809.2-515s1c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000298160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-515s21c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000298162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1642s21c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000293570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1853s21c1
Sequence:CCGGTTTCCCACACACAGCTCATATCTCGAGATATGAGCTGTGTGTGGGAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-926s21c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-783s21c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002809
VALIDATED
PSMD3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000058120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1239s1c1
Sequence:CCGGCCCTATTTCCTTCTGACTCAACTCGAGTTGAGTCAGAAGGAAATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-1642s1c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-783s1c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002809.2-926s1c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002809.2-515s1c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-515s21c1
Sequence:CCGGGCAGGGCTTCTTCACTTCAAACTCGAGTTTGAAGTGAAGAAGCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1642s21c1
Sequence:CCGGCCATGAGGTTTCCTCCCAAATCTCGAGATTTGGGAGGAAACCTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-1853s21c1
Sequence:CCGGTTTCCCACACACAGCTCATATCTCGAGATATGAGCTGTGTGTGGGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-926s21c1
Sequence:CCGGGCTGCGGAATTACCTACACTACTCGAGTAGTGTAGGTAATTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002809.2-783s21c1
Sequence:CCGGGCCGCAAAGTGTTACTATTATCTCGAGATAATAGTAACACTTTGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)