EMAIL THIS PAGE TO A FRIEND

PSMD4

proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

54 Gene Product Result for
Synonyms: AF AF-1 ASF MCB1 Rpn10 S5A pUB-R5
UniProtKB ID: P55036, D3DV16, Q5VWC5, Q9NS92
Gene ID:
Human(5710) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
Mouse(19185) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Rat(83499) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
cow(282016) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
sheep(100101235) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
naked mole-rat(101702092) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Domestic Rabbit(100328669) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
domestic guinea pig(101788278) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
chicken(100216364) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
dog(100192385) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Horse(100216429) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
domestic cat(101098564) proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002810 Rosetta Predictions human pricing
NM_153822 Rosetta Predictions human pricing
NM_031331 Rosetta Predictions rat pricing
NM_008951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226402 predicted 948
2 SASI_Hs01_00226403 predicted 955
3 SASI_Hs01_00226400 predicted 75
4 SASI_Hs01_00226401 predicted 75
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179690 predicted 981
2 SASI_Hs01_00179691 predicted 816
3 SASI_Hs01_00179692 predicted 73
4 SASI_Hs01_00179693 predicted 971
5 SASI_Hs01_00179694 predicted 78
6 SASI_Hs01_00179695 predicted 1154
7 SASI_Hs01_00179696 predicted 1147
8 SASI_Hs01_00179697 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264553 predicted 451
2 SASI_Rn01_00067382 predicted 614
3 SASI_Rn01_00067383 predicted 971
4 SASI_Rn01_00067384 predicted 447
5 SASI_Rn01_00067386 predicted 517
6 SASI_Rn01_00067387 predicted 430
7 SASI_Rn01_00067388 predicted 474
8 SASI_Rn01_00067389 predicted 726
9 SASI_Rn02_00264554 predicted 1106
10 SASI_Rn02_00264555 predicted 216
11 SASI_Rn01_00067380 predicted 673
12 SASI_Rn01_00067381 predicted 672
13 SASI_Rn01_00067385 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162240 predicted 662
2 SASI_Mm02_00315014 predicted 394
3 SASI_Mm01_00162242 predicted 614
4 SASI_Mm01_00162243 predicted 607
5 SASI_Mm01_00162244 predicted 381
6 SASI_Mm01_00162245 predicted 892
7 SASI_Mm01_00162246 predicted 968
8 SASI_Mm01_00162248 predicted 479
9 SASI_Mm01_00162249 predicted 939
10 SASI_Mm02_00315015 predicted 564
11 SASI_Mm01_00162241 predicted 557
12 SASI_Mm01_00162247 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002810
VALIDATED
PSMD4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1245s21c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-359s21c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-90s21c1
Sequence:CCGGGTGGACAACAGTGAGTATATGCTCGAGCATATACTCACTGTTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-607s21c1
Sequence:CCGGCTCTCATCAGTTCTCCGATTTCTCGAGAAATCGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1105s21c1
Sequence:CCGGACAATGAAGCCATTCGAAATGCTCGAGCATTTCGAATGGCTTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-359s1c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-195s1c1
Sequence:CCGGCCTGAGAACAACGTGGGCCTTCTCGAGAAGGCCCACGTTGTTCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002810.x-1245s1c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002810
VALIDATED
PSMD4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1245s21c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-359s21c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-90s21c1
Sequence:CCGGGTGGACAACAGTGAGTATATGCTCGAGCATATACTCACTGTTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-607s21c1
Sequence:CCGGCTCTCATCAGTTCTCCGATTTCTCGAGAAATCGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1105s21c1
Sequence:CCGGACAATGAAGCCATTCGAAATGCTCGAGCATTTCGAATGGCTTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-359s1c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-195s1c1
Sequence:CCGGCCTGAGAACAACGTGGGCCTTCTCGAGAAGGCCCACGTTGTTCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002810.x-1245s1c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002810
VALIDATED
PSMD4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1245s21c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-359s21c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-90s21c1
Sequence:CCGGGTGGACAACAGTGAGTATATGCTCGAGCATATACTCACTGTTGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-607s21c1
Sequence:CCGGCTCTCATCAGTTCTCCGATTTCTCGAGAAATCGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002810.2-1105s21c1
Sequence:CCGGACAATGAAGCCATTCGAAATGCTCGAGCATTTCGAATGGCTTCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-359s1c1
Sequence:CCGGCCGACAAGGCAAGAATCACAACTCGAGTTGTGATTCTTGCCTTGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002810.x-195s1c1
Sequence:CCGGCCTGAGAACAACGTGGGCCTTCTCGAGAAGGCCCACGTTGTTCTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002810.x-1245s1c1
Sequence:CCGGGCACGGAATATAGGGTTAGATCTCGAGATCTAACCCTATATTCCGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008951
VALIDATED
PSMD4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-893s21c1
Sequence:CCGGCCCTGCAGGGAACAGAGTTTACTCGAGTAAACTCTGTTCCCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-387s21c1
Sequence:GTACCGGGAAACTAGCTAAACGCCTTAACTCGAGTTAAGGCGTTTAGCTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-418s21c1
Sequence:CCGGGTGAATGTTGACATCATTAATCTCGAGATTAATGATGTCAACATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-98s21c1
Sequence:CCGGAGCAGGATGCCGTCAACATTGCTCGAGCAATGTTGACGGCATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-312s1c1
Sequence:CCGGGCAGGGCAAGAATCACAAGATCTCGAGATCTTGTGATTCTTGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-789s1c1
Sequence:CCGGCCTACTGAAGATGACCATCAACTCGAGTTGATGGTCATCTTCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-1045s1c1
Sequence:CCGGGATCCCAACAATGCAGCCATTCTCGAGAATGGCTGCATTGTTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-475s1c1
Sequence:CCGGGCCTTTGTGAACACACTGAATCTCGAGATTCAGTGTGTTCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-111s1c1
Sequence:CCGGCAACATTGTATGTCACTCAAACTCGAGTTTGAGTGACATACAATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-557s21c1
Sequence:CCGGCTCTCATCAGTTCTCCTATTCCTCGAGGAATAGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008951
VALIDATED
PSMD4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-893s21c1
Sequence:CCGGCCCTGCAGGGAACAGAGTTTACTCGAGTAAACTCTGTTCCCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-387s21c1
Sequence:GTACCGGGAAACTAGCTAAACGCCTTAACTCGAGTTAAGGCGTTTAGCTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-418s21c1
Sequence:CCGGGTGAATGTTGACATCATTAATCTCGAGATTAATGATGTCAACATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-98s21c1
Sequence:CCGGAGCAGGATGCCGTCAACATTGCTCGAGCAATGTTGACGGCATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-312s1c1
Sequence:CCGGGCAGGGCAAGAATCACAAGATCTCGAGATCTTGTGATTCTTGCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-789s1c1
Sequence:CCGGCCTACTGAAGATGACCATCAACTCGAGTTGATGGTCATCTTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-1045s1c1
Sequence:CCGGGATCCCAACAATGCAGCCATTCTCGAGAATGGCTGCATTGTTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-475s1c1
Sequence:CCGGGCCTTTGTGAACACACTGAATCTCGAGATTCAGTGTGTTCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-111s1c1
Sequence:CCGGCAACATTGTATGTCACTCAAACTCGAGTTTGAGTGACATACAATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-557s21c1
Sequence:CCGGCTCTCATCAGTTCTCCTATTCCTCGAGGAATAGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008951
VALIDATED
PSMD4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-893s21c1
Sequence:CCGGCCCTGCAGGGAACAGAGTTTACTCGAGTAAACTCTGTTCCCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-387s21c1
Sequence:GTACCGGGAAACTAGCTAAACGCCTTAACTCGAGTTAAGGCGTTTAGCTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-418s21c1
Sequence:CCGGGTGAATGTTGACATCATTAATCTCGAGATTAATGATGTCAACATTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-98s21c1
Sequence:CCGGAGCAGGATGCCGTCAACATTGCTCGAGCAATGTTGACGGCATCCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-312s1c1
Sequence:CCGGGCAGGGCAAGAATCACAAGATCTCGAGATCTTGTGATTCTTGCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008951.1-789s1c1
Sequence:CCGGCCTACTGAAGATGACCATCAACTCGAGTTGATGGTCATCTTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-1045s1c1
Sequence:CCGGGATCCCAACAATGCAGCCATTCTCGAGAATGGCTGCATTGTTGGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-475s1c1
Sequence:CCGGGCCTTTGTGAACACACTGAATCTCGAGATTCAGTGTGTTCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008951.1-111s1c1
Sequence:CCGGCAACATTGTATGTCACTCAAACTCGAGTTTGAGTGACATACAATGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008951.1-557s21c1
Sequence:CCGGCTCTCATCAGTTCTCCTATTCCTCGAGGAATAGGAGAACTGATGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)