EMAIL THIS PAGE TO A FRIEND

PSMD5

proteasome (prosome, macropain) 26S subunit, non-ATPase, 5

86 Gene Product Result for
Synonyms: S5B
UniProtKB ID: Q16401, B4DZM8, Q15045, Q4VXG8
Gene ID:
Human(5711) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly. [provided by RefSeq, Jul 2012]
Mouse(66998) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Rat(296651) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Zebrafish(550235) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
chicken(417125) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
domestic cat(101086760) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
dog(474703) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
domestic guinea pig(100723691) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Domestic Rabbit(100339098) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
naked mole-rat(101712371) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
cow(515021) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
sheep(101122326) proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005047 Rosetta Predictions human pricing
NM_001106569 Rosetta Predictions rat pricing
NM_080554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149177 predicted 1466
2 SASI_Hs01_00149178 predicted 1389
3 SASI_Hs01_00149180 predicted 321
4 SASI_Hs01_00149181 predicted 702
5 SASI_Hs02_00338846 predicted 1263
6 SASI_Hs01_00149183 predicted 943
7 SASI_Hs01_00149184 predicted 219
8 SASI_Hs01_00149185 predicted 854
9 SASI_Hs01_00149186 predicted 1580
10 SASI_Hs02_00338847 predicted 1050
11 SASI_Hs01_00149179 predicted 433
12 SASI_Hs01_00149182 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220248 predicted 1532
2 SASI_Rn02_00220249 predicted 579
3 SASI_Rn02_00220250 predicted 780
4 SASI_Rn02_00220251 predicted 1381
5 SASI_Rn02_00220252 predicted 1484
6 SASI_Rn02_00220253 predicted 576
7 SASI_Rn02_00220254 predicted 1378
8 SASI_Rn02_00220255 predicted 943
9 SASI_Rn02_00220256 predicted 597
10 SASI_Rn02_00220257 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167336 predicted 929
2 SASI_Mm01_00167338 predicted 1398
3 SASI_Mm02_00338152 predicted 695
4 SASI_Mm01_00167340 predicted 454
5 SASI_Mm01_00167341 predicted 961
6 SASI_Mm01_00167342 predicted 1499
7 SASI_Mm01_00167343 predicted 801
8 SASI_Mm01_00167344 predicted 1483
9 SASI_Mm01_00167345 predicted 526
10 SASI_Mm02_00338153 predicted 260
11 SASI_Mm01_00167337 predicted 462
12 SASI_Mm01_00167339 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005047
VALIDATED
PSMD5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-171s1c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-860s1c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005047.2-696s1c1
Sequence:CCGGCCTGTATAGAAATGGTGACATCTCGAGATGTCACCATTTCTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-1484s1c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-462s1c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-860s21c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-171s21c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-462s21c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-1484s21c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005047
VALIDATED
PSMD5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-171s1c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-860s1c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005047.2-696s1c1
Sequence:CCGGCCTGTATAGAAATGGTGACATCTCGAGATGTCACCATTTCTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-1484s1c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-462s1c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-860s21c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-171s21c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-462s21c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-1484s21c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005047
VALIDATED
PSMD5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-171s1c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-860s1c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005047.2-696s1c1
Sequence:CCGGCCTGTATAGAAATGGTGACATCTCGAGATGTCACCATTTCTATACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-1484s1c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005047.2-462s1c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-860s21c1
Sequence:CCGGGCTGTCATGGATAGTCCTCAACTCGAGTTGAGGACTATCCATGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-171s21c1
Sequence:CCGGCCCTGCTTAACGAGAACCATACTCGAGTATGGTTCTCGTTAAGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-462s21c1
Sequence:CCGGCCCTGTCAAGAATATCACTAACTCGAGTTAGTGATATTCTTGACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005047.2-1484s21c1
Sequence:CCGGCCATACTATGTGAAACCTGTTCTCGAGAACAGGTTTCACATAGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080554
VALIDATED
PSMD5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-494s1c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-231s1c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-421s1c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1499s1c1
Sequence:CCGGCGTACCTAAGTGAAGGTCCATCTCGAGATGGACCTTCACTTAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1381s1c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-483s21c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-410s21c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-1370s21c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-220s21c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080554
VALIDATED
PSMD5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-494s1c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-231s1c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-421s1c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1499s1c1
Sequence:CCGGCGTACCTAAGTGAAGGTCCATCTCGAGATGGACCTTCACTTAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1381s1c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-483s21c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-410s21c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-1370s21c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-220s21c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080554
VALIDATED
PSMD5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-494s1c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-231s1c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-421s1c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1499s1c1
Sequence:CCGGCGTACCTAAGTGAAGGTCCATCTCGAGATGGACCTTCACTTAGGTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080554.1-1381s1c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-483s21c1
Sequence:CCGGCCCTGTCGAGAATATCACTAACTCGAGTTAGTGATATTCTCGACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-410s21c1
Sequence:CCGGGCTGAGCTGTTGAAACAGATTCTCGAGAATCTGTTTCAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-1370s21c1
Sequence:CCGGCGGTCTGTGGAACATGACAAACTCGAGTTTGTCATGTTCCACAGACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080554.2-220s21c1
Sequence:CCGGGACTGCTTTGTGTGTCTCCATCTCGAGATGGAGACACACAAAGCAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)