EMAIL THIS PAGE TO A FRIEND

PSMD6

proteasome (prosome, macropain) 26S subunit, non-ATPase, 6

54 Gene Product Result for
Synonyms: Rpn7 S10 SGA-113M p42A p44S10
UniProtKB ID: Q15008, A8K2E0
Gene ID:
Human(9861) Summary: This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Mouse(66413) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Rat(289924) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Zebrafish(393261) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
chicken(416079) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Horse(100055920) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
domestic cat(101085106) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
dog(484700) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
cow(538625) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
sheep(101119337) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
naked mole-rat(101703034) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Domestic Rabbit(100339067) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
domestic guinea pig(100715202) proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014814 Rosetta Predictions human pricing
NM_198730 Rosetta Predictions rat pricing
NM_025550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179591 predicted 295
2 SASI_Hs01_00179592 predicted 571
3 SASI_Hs01_00179593 predicted 807
4 SASI_Hs01_00179594 predicted 570
5 SASI_Hs01_00179595 predicted 954
6 SASI_Hs01_00179596 predicted 893
7 SASI_Hs01_00179597 predicted 480
8 SASI_Hs01_00179598 predicted 916
9 SASI_Hs01_00179599 predicted 912
10 SASI_Hs02_00346345 predicted 742
11 SASI_Hs01_00179590 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053367 predicted 322
2 SASI_Rn01_00053368 predicted 366
3 SASI_Rn01_00053369 predicted 311
4 SASI_Rn01_00053370 predicted 994
5 SASI_Rn02_00269936 predicted 586
6 SASI_Rn01_00053371 predicted 422
7 SASI_Rn01_00053372 predicted 997
8 SASI_Rn01_00053373 predicted 321
9 SASI_Rn01_00053374 predicted 686
10 SASI_Rn01_00053375 predicted 932
11 SASI_Rn01_00053376 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047115 predicted 801
2 SASI_Mm01_00047116 predicted 970
3 SASI_Mm02_00328495 predicted 297
4 SASI_Mm01_00047117 predicted 338
5 SASI_Mm01_00047118 predicted 947
6 SASI_Mm01_00047119 predicted 283
7 SASI_Mm01_00047120 predicted 745
8 SASI_Mm01_00047121 predicted 663
9 SASI_Mm01_00047122 predicted 631
10 SASI_Mm01_00047123 predicted 947
11 SASI_Mm01_00047124 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014814
VALIDATED
PSMD6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-764s21c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-764s1c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-946s1c1
Sequence:CCGGGCTGGAATCATATAGGTCATTCTCGAGAATGACCTATATGATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1117s21c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-163s1c1
Sequence:CCGGCGATAACAACATGGCTCCTTACTCGAGTAAGGAGCCATGTTGTTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-388s21c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1117s1c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-388s1c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1019s1c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-841s1c1
Sequence:CCGGCCAATCATTAGCGGTTGTGGACTCGAGTCCACAACCGCTAATGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1127s1c1
Sequence:CCGGGAAACTATCAAGAAAGGAGATCTCGAGATCTCCTTTCTTGATAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1019s21c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1016s1c1
Sequence:CCGGGATCAGGAACTGTCCAGGTTTCTCGAGAAACCTGGACAGTTCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014814
VALIDATED
PSMD6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-764s21c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-764s1c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-946s1c1
Sequence:CCGGGCTGGAATCATATAGGTCATTCTCGAGAATGACCTATATGATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1117s21c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-163s1c1
Sequence:CCGGCGATAACAACATGGCTCCTTACTCGAGTAAGGAGCCATGTTGTTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-388s21c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1117s1c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-388s1c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1019s1c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-841s1c1
Sequence:CCGGCCAATCATTAGCGGTTGTGGACTCGAGTCCACAACCGCTAATGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1127s1c1
Sequence:CCGGGAAACTATCAAGAAAGGAGATCTCGAGATCTCCTTTCTTGATAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1019s21c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1016s1c1
Sequence:CCGGGATCAGGAACTGTCCAGGTTTCTCGAGAAACCTGGACAGTTCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014814
VALIDATED
PSMD6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-764s21c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-764s1c1
Sequence:CCGGCTTGAAGTGTTGCACAGTCTTCTCGAGAAGACTGTGCAACACTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-946s1c1
Sequence:CCGGGCTGGAATCATATAGGTCATTCTCGAGAATGACCTATATGATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1117s21c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-163s1c1
Sequence:CCGGCGATAACAACATGGCTCCTTACTCGAGTAAGGAGCCATGTTGTTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-388s21c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1117s1c1
Sequence:CCGGGCAGTACCAAGAAACTATCAACTCGAGTTGATAGTTTCTTGGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014814.1-388s1c1
Sequence:CCGGGACAGCCTTTCGCAAGACATACTCGAGTATGTCTTGCGAAAGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1019s1c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-841s1c1
Sequence:CCGGCCAATCATTAGCGGTTGTGGACTCGAGTCCACAACCGCTAATGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1127s1c1
Sequence:CCGGGAAACTATCAAGAAAGGAGATCTCGAGATCTCCTTTCTTGATAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014814.1-1019s21c1
Sequence:CCGGCAGGAACTGTCCAGGTTTATTCTCGAGAATAAACCTGGACAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014814.1-1016s1c1
Sequence:CCGGGATCAGGAACTGTCCAGGTTTCTCGAGAAACCTGGACAGTTCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025550
VALIDATED
PSMD6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-343s1c1
Sequence:CCGGGCAGAGTACCTCTGTCAGATACTCGAGTATCTGACAGAGGTACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-957s1c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025550.2-391s21c1
Sequence:CCGGTTTCGCAAGACATACGATAAGCTCGAGCTTATCGTATGTCTTGCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-957s21c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-887s21c1
Sequence:CCGGCGCCTCATTACCGATACTATGCTCGAGCATAGTATCGGTAATGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-807s21c1
Sequence:CCGGTCTCTATGAATGCCGTTATTCCTCGAGGAATAACGGCATTCATAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-886s1c1
Sequence:CCGGGCGCCTCATTACCGATACTATCTCGAGATAGTATCGGTAATGAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-626s21c1
Sequence:CCGGTCGACACTGTTTCTACGTTTACTCGAGTAAACGTAGAAACAGTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025550
VALIDATED
PSMD6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-343s1c1
Sequence:CCGGGCAGAGTACCTCTGTCAGATACTCGAGTATCTGACAGAGGTACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-957s1c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025550.2-391s21c1
Sequence:CCGGTTTCGCAAGACATACGATAAGCTCGAGCTTATCGTATGTCTTGCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-957s21c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-887s21c1
Sequence:CCGGCGCCTCATTACCGATACTATGCTCGAGCATAGTATCGGTAATGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-807s21c1
Sequence:CCGGTCTCTATGAATGCCGTTATTCCTCGAGGAATAACGGCATTCATAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-886s1c1
Sequence:CCGGGCGCCTCATTACCGATACTATCTCGAGATAGTATCGGTAATGAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-626s21c1
Sequence:CCGGTCGACACTGTTTCTACGTTTACTCGAGTAAACGTAGAAACAGTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025550
VALIDATED
PSMD6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-343s1c1
Sequence:CCGGGCAGAGTACCTCTGTCAGATACTCGAGTATCTGACAGAGGTACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-957s1c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025550.2-391s21c1
Sequence:CCGGTTTCGCAAGACATACGATAAGCTCGAGCTTATCGTATGTCTTGCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-957s21c1
Sequence:CCGGGTCATTAACCCTCGGCTATATCTCGAGATATAGCCGAGGGTTAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-887s21c1
Sequence:CCGGCGCCTCATTACCGATACTATGCTCGAGCATAGTATCGGTAATGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-807s21c1
Sequence:CCGGTCTCTATGAATGCCGTTATTCCTCGAGGAATAACGGCATTCATAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025550.2-886s1c1
Sequence:CCGGGCGCCTCATTACCGATACTATCTCGAGATAGTATCGGTAATGAGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025550.2-626s21c1
Sequence:CCGGTCGACACTGTTTCTACGTTTACTCGAGTAAACGTAGAAACAGTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)