EMAIL THIS PAGE TO A FRIEND

PSMD8

proteasome (prosome, macropain) 26S subunit, non-ATPase, 8

74 Gene Product Result for
Synonyms: HIP6 HYPF Nin1p Rpn12 S14 p31
UniProtKB ID: P48556, B4DX18, Q6P1L7
Gene ID:
Human(5714) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(57296) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Rat(292766) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Zebrafish(415221) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
domestic cat(101095457) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
dog(476470) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
cow(512891) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
sheep(101111572) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
naked mole-rat(101706427) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
domestic guinea pig(100731823) proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002812 Rosetta Predictions human pricing
XM_001075072 Rosetta Predictions rat pricing
XM_214888 Rosetta Predictions rat pricing
NM_026545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334496 predicted 216
2 SASI_Hs01_00202769 predicted 451
3 SASI_Hs01_00202770 predicted 1164
4 SASI_Hs01_00202771 predicted 1144
5 SASI_Hs01_00202772 predicted 1036
6 SASI_Hs01_00202775 predicted 415
7 SASI_Hs01_00202776 predicted 452
8 SASI_Hs02_00334497 predicted 1164
9 SASI_Hs02_00334498 predicted 462
10 SASI_Hs02_00334499 predicted 1268
11 SASI_Hs01_00202767 predicted 678
12 SASI_Hs01_00202768 predicted 1123
13 SASI_Hs01_00202773 predicted 672
14 SASI_Hs01_00202774 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348350 predicted 265
2 SASI_Rn02_00348351 predicted 708
3 SASI_Rn02_00348352 predicted 754
4 SASI_Rn02_00348353 predicted 697
5 SASI_Rn02_00348354 predicted 546
6 SASI_Rn02_00348355 predicted 551
7 SASI_Rn02_00348356 predicted 470
8 SASI_Rn02_00348357 predicted 1211
9 SASI_Rn02_00348358 predicted 331
10 SASI_Rn02_00348359 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375667 predicted 209
2 SASI_Rn02_00375668 predicted 731
3 SASI_Rn02_00375669 predicted 872
4 SASI_Rn02_00375670 predicted 543
5 SASI_Rn02_00375671 predicted 1157
6 SASI_Rn02_00375672 predicted 471
7 SASI_Rn02_00375673 predicted 330
8 SASI_Rn02_00375674 predicted 814
9 SASI_Rn02_00375675 predicted 461
10 SASI_Rn02_00375676 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330471 predicted 305
2 SASI_Mm02_00330472 predicted 850
3 SASI_Mm02_00330473 predicted 1021
4 SASI_Mm01_00130682 predicted 440
5 SASI_Mm01_00130683 predicted 458
6 SASI_Mm01_00130684 predicted 1042
7 SASI_Mm02_00330474 predicted 833
8 SASI_Mm01_00130685 predicted 1099
9 SASI_Mm01_00130686 predicted 1142
10 SASI_Mm01_00130687 predicted 438
11 SASI_Mm01_00130681 predicted 655
12 SASI_Mm01_00130688 predicted 218
13 SASI_Mm01_00130689 predicted 887
14 SASI_Mm01_00130690 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026545
VALIDATED
PSMD8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-444s21c1
Sequence:CCGGTGACTAAACAGCAACTCATTCCTCGAGGAATGAGTTGCTGTTTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-752s21c1
Sequence:CCGGGGTAGCTACAACAAGGTATTCCTCGAGGAATACCTTGTTGTAGCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1043s21c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-902s1c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-520s1c1
Sequence:CCGGCCACACAGAATTAGAACGATTCTCGAGAATCGTTCTAATTCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-830s1c1
Sequence:CCGGCCTAACAACTACTACAGCTTTCTCGAGAAAGCTGTAGTAGTTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-403s1c1
Sequence:CCGGCCAACTCAAATGCTACTACTTCTCGAGAAGTAGTAGCATTTGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-352s21c1
Sequence:CCGGGAACCCGAACCTTAGTAAATGCTCGAGCATTTACTAAGGTTCGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1143s21c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-1002s1c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026545
VALIDATED
PSMD8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-444s21c1
Sequence:CCGGTGACTAAACAGCAACTCATTCCTCGAGGAATGAGTTGCTGTTTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-752s21c1
Sequence:CCGGGGTAGCTACAACAAGGTATTCCTCGAGGAATACCTTGTTGTAGCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1043s21c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-902s1c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-520s1c1
Sequence:CCGGCCACACAGAATTAGAACGATTCTCGAGAATCGTTCTAATTCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-830s1c1
Sequence:CCGGCCTAACAACTACTACAGCTTTCTCGAGAAAGCTGTAGTAGTTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-403s1c1
Sequence:CCGGCCAACTCAAATGCTACTACTTCTCGAGAAGTAGTAGCATTTGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-352s21c1
Sequence:CCGGGAACCCGAACCTTAGTAAATGCTCGAGCATTTACTAAGGTTCGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1143s21c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-1002s1c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026545
VALIDATED
PSMD8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-444s21c1
Sequence:CCGGTGACTAAACAGCAACTCATTCCTCGAGGAATGAGTTGCTGTTTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-752s21c1
Sequence:CCGGGGTAGCTACAACAAGGTATTCCTCGAGGAATACCTTGTTGTAGCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1043s21c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-902s1c1
Sequence:CCGGGCCAAACAAGTCATCGAGTATCTCGAGATACTCGATGACTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-520s1c1
Sequence:CCGGCCACACAGAATTAGAACGATTCTCGAGAATCGTTCTAATTCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-830s1c1
Sequence:CCGGCCTAACAACTACTACAGCTTTCTCGAGAAAGCTGTAGTAGTTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026545.1-403s1c1
Sequence:CCGGCCAACTCAAATGCTACTACTTCTCGAGAAGTAGTAGCATTTGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-352s21c1
Sequence:CCGGGAACCCGAACCTTAGTAAATGCTCGAGCATTTACTAAGGTTCGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026545.3-1143s21c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026545.1-1002s1c1
Sequence:CCGGGCCTTCAATAAAGGCAGATTACTCGAGTAATCTGCCTTTATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002812
PSMD8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-426s1c1
Sequence:CCGGGCTGACCAAACAGCAGCTAATCTCGAGATTAGCTGCTGTTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-915s1c1
Sequence:CCGGGATGACAGACTACGCCAAGAACTCGAGTTCTTGGCGTAGTCTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-527s1c1
Sequence:CCGGCCCAGCTCAAATGCTACTACTCTCGAGAGTAGTAGCATTTGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-1027s1c1
Sequence:CCGGGCCAAACAGGTCATCGAGTATCTCGAGATACTCGATGACCTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-813s1c1
Sequence:CCGGCGACACTATCAGGGATGAGATCTCGAGATCTCATCCCTGATAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002812
PSMD8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-426s1c1
Sequence:CCGGGCTGACCAAACAGCAGCTAATCTCGAGATTAGCTGCTGTTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-915s1c1
Sequence:CCGGGATGACAGACTACGCCAAGAACTCGAGTTCTTGGCGTAGTCTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-527s1c1
Sequence:CCGGCCCAGCTCAAATGCTACTACTCTCGAGAGTAGTAGCATTTGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-1027s1c1
Sequence:CCGGGCCAAACAGGTCATCGAGTATCTCGAGATACTCGATGACCTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-813s1c1
Sequence:CCGGCGACACTATCAGGGATGAGATCTCGAGATCTCATCCCTGATAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002812
PSMD8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-426s1c1
Sequence:CCGGGCTGACCAAACAGCAGCTAATCTCGAGATTAGCTGCTGTTTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-915s1c1
Sequence:CCGGGATGACAGACTACGCCAAGAACTCGAGTTCTTGGCGTAGTCTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-527s1c1
Sequence:CCGGCCCAGCTCAAATGCTACTACTCTCGAGAGTAGTAGCATTTGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-1027s1c1
Sequence:CCGGGCCAAACAGGTCATCGAGTATCTCGAGATACTCGATGACCTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002812.3-813s1c1
Sequence:CCGGCGACACTATCAGGGATGAGATCTCGAGATCTCATCCCTGATAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)