EMAIL THIS PAGE TO A FRIEND

PSME4

proteasome (prosome, macropain) activator subunit 4

116 Gene Product Result for
Synonyms: PA200
Gene ID:
Mouse(103554) proteasome (prosome, macropain) activator subunit 4
Rat(498433) proteasome (prosome, macropain) activator subunit 4
domestic guinea pig(100716029) proteasome (prosome, macropain) activator subunit 4
naked mole-rat(101718665) proteasome (prosome, macropain) activator subunit 4
Domestic Rabbit(100340473) proteasome (prosome, macropain) activator subunit 4
cow(528142) proteasome (prosome, macropain) activator subunit 4
sheep(101103140) proteasome (prosome, macropain) activator subunit 4
chicken(421218) proteasome (prosome, macropain) activator subunit 4
dog(474594) proteasome (prosome, macropain) activator subunit 4
domestic cat(101095332) proteasome (prosome, macropain) activator subunit 4
Horse(100066926) proteasome (prosome, macropain) activator subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060922 Anti-PSME4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080741 MISSION® esiRNA esiRNA targeting mouse Psme4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014614 Rosetta Predictions human pricing
XM_001055468 Rosetta Predictions rat pricing
XM_001066053 Rosetta Predictions rat pricing
NM_134013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059954 predicted 2776
2 SASI_Hs01_00059956 predicted 3629
3 SASI_Hs01_00059957 predicted 2905
4 SASI_Hs01_00059958 predicted 1328
5 SASI_Hs01_00059959 predicted 3775
6 SASI_Hs01_00059960 predicted 3056
7 SASI_Hs01_00059961 predicted 1370
8 SASI_Hs01_00059962 predicted 3642
9 SASI_Hs01_00059963 predicted 3395
10 SASI_Hs02_00345904 predicted 1796
11 SASI_Hs01_00059955 predicted 3626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279641 predicted 2441
2 SASI_Rn02_00279642 predicted 4959
3 SASI_Rn02_00279643 predicted 2873
4 SASI_Rn02_00279644 predicted 5668
5 SASI_Rn02_00279645 predicted 5615
6 SASI_Rn02_00279646 predicted 4082
7 SASI_Rn02_00279647 predicted 2609
8 SASI_Rn02_00279648 predicted 4659
9 SASI_Rn02_00279649 predicted 3229
10 SASI_Rn02_00279650 predicted 3482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316179 predicted 2450
2 SASI_Rn02_00316180 predicted 4961
3 SASI_Rn02_00316181 predicted 3924
4 SASI_Rn02_00316182 predicted 2877
5 SASI_Rn02_00316183 predicted 5664
6 SASI_Rn02_00316184 predicted 5620
7 SASI_Rn02_00316185 predicted 4076
8 SASI_Rn02_00316186 predicted 2601
9 SASI_Rn02_00316187 predicted 3230
10 SASI_Rn02_00316188 predicted 3486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339162 predicted 2151
2 SASI_Mm02_00339163 predicted 5611
3 SASI_Mm01_00186683 predicted 3784
4 SASI_Mm01_00186685 predicted 2931
5 SASI_Mm01_00186686 predicted 5464
6 SASI_Mm01_00186687 predicted 4366
7 SASI_Mm01_00186688 predicted 2616
8 SASI_Mm01_00186689 predicted 3793
9 SASI_Mm02_00339164 predicted 5614
10 SASI_Mm02_00339165 predicted 5260
11 SASI_Mm01_00186680 predicted 3714
12 SASI_Mm01_00186681 predicted 3341
13 SASI_Mm01_00186682 predicted 5308
14 SASI_Mm01_00186684 predicted 3605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014614
VALIDATED
PSME4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) activator subunit 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-4434s21c1
Sequence:CCGGGTAGATGCATGTCGACTTTATCTCGAGATAAAGTCGACATGCATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-5111s21c1
Sequence:CCGGTATCAGGTGGCTGGTTATAAGCTCGAGCTTATAACCAGCCACCTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-1097s21c1
Sequence:CCGGGCGCTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-4519s1c1
Sequence:CCGGCCCTGAGTTTACTGCTCGAATCTCGAGATTCGAGCAGTAAACTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-5873s1c1
Sequence:CCGGGCTGCTGGATTTAGGTGGTAACTCGAGTTACCACCTAAATCCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-4835s1c1
Sequence:CCGGCCTCATCAAGTGCCTTTGGTACTCGAGTACCAAAGGCACTTGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-1004s1c1
Sequence:CCGGCGGTTGCCAAACAGTGTTGTTCTCGAGAACAACACTGTTTGGCAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014614.1-3240s1c1
Sequence:CCGGCGGAATTACTTCAACAGTCAACTCGAGTTGACTGTTGAAGTAATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-3093s1c1
Sequence:CCGGCGATTGTTTCTTCAGGGCTTACTCGAGTAAGCCCTGAAGAAACAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014614.1-5619s1c1
Sequence:CCGGGCTTCTCAGTTGCCATTTGATCTCGAGATCAAATGGCAACTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-6327s1c1
Sequence:CCGGGCAGAATCGTTGAGAGACTAACTCGAGTTAGTCTCTCAACGATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014614
VALIDATED
PSME4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) activator subunit 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-4434s21c1
Sequence:CCGGGTAGATGCATGTCGACTTTATCTCGAGATAAAGTCGACATGCATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-5111s21c1
Sequence:CCGGTATCAGGTGGCTGGTTATAAGCTCGAGCTTATAACCAGCCACCTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-1097s21c1
Sequence:CCGGGCGCTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-4519s1c1
Sequence:CCGGCCCTGAGTTTACTGCTCGAATCTCGAGATTCGAGCAGTAAACTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-5873s1c1
Sequence:CCGGGCTGCTGGATTTAGGTGGTAACTCGAGTTACCACCTAAATCCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-4835s1c1
Sequence:CCGGCCTCATCAAGTGCCTTTGGTACTCGAGTACCAAAGGCACTTGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-1004s1c1
Sequence:CCGGCGGTTGCCAAACAGTGTTGTTCTCGAGAACAACACTGTTTGGCAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014614.1-3240s1c1
Sequence:CCGGCGGAATTACTTCAACAGTCAACTCGAGTTGACTGTTGAAGTAATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-3093s1c1
Sequence:CCGGCGATTGTTTCTTCAGGGCTTACTCGAGTAAGCCCTGAAGAAACAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014614.1-5619s1c1
Sequence:CCGGGCTTCTCAGTTGCCATTTGATCTCGAGATCAAATGGCAACTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-6327s1c1
Sequence:CCGGGCAGAATCGTTGAGAGACTAACTCGAGTTAGTCTCTCAACGATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014614
VALIDATED
PSME4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) activator subunit 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-4434s21c1
Sequence:CCGGGTAGATGCATGTCGACTTTATCTCGAGATAAAGTCGACATGCATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-5111s21c1
Sequence:CCGGTATCAGGTGGCTGGTTATAAGCTCGAGCTTATAACCAGCCACCTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014614.2-1097s21c1
Sequence:CCGGGCGCTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-4519s1c1
Sequence:CCGGCCCTGAGTTTACTGCTCGAATCTCGAGATTCGAGCAGTAAACTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-5873s1c1
Sequence:CCGGGCTGCTGGATTTAGGTGGTAACTCGAGTTACCACCTAAATCCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-4835s1c1
Sequence:CCGGCCTCATCAAGTGCCTTTGGTACTCGAGTACCAAAGGCACTTGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014614.1-1004s1c1
Sequence:CCGGCGGTTGCCAAACAGTGTTGTTCTCGAGAACAACACTGTTTGGCAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014614.1-3240s1c1
Sequence:CCGGCGGAATTACTTCAACAGTCAACTCGAGTTGACTGTTGAAGTAATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014614.1-3093s1c1
Sequence:CCGGCGATTGTTTCTTCAGGGCTTACTCGAGTAAGCCCTGAAGAAACAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014614.1-5619s1c1
Sequence:CCGGGCTTCTCAGTTGCCATTTGATCTCGAGATCAAATGGCAACTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014614.1-6327s1c1
Sequence:CCGGGCAGAATCGTTGAGAGACTAACTCGAGTTAGTCTCTCAACGATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134013
VALIDATED
PSME4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) activator subunit 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134013.3-6010s1c1
Sequence:CCGGCTAGTACTATCATGGTATTATCTCGAGATAATACCATGATAGTACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-1249s1c1
Sequence:CCGGGCGTTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-2911s1c1
Sequence:CCGGGCACTTCCAAGGATCTCATAACTCGAGTTATGAGATCCTTGGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-436s21c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-638s21c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-1693s21c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-3415s21c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-147s1c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-3126s1c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-1404s1c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-507s1c1
Sequence:CCGGGCGGCCTTTAATGTGTCCTTTCTCGAGAAAGGACACATTAAAGGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.2-3384s1c1
Sequence:CCGGGCAAAGAAATCTGCCTTGGAACTCGAGTTCCAAGGCAGATTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-349s1c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134013
VALIDATED
PSME4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) activator subunit 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134013.3-6010s1c1
Sequence:CCGGCTAGTACTATCATGGTATTATCTCGAGATAATACCATGATAGTACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-1249s1c1
Sequence:CCGGGCGTTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-2911s1c1
Sequence:CCGGGCACTTCCAAGGATCTCATAACTCGAGTTATGAGATCCTTGGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-436s21c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-638s21c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-1693s21c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-3415s21c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-147s1c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-3126s1c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-1404s1c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-507s1c1
Sequence:CCGGGCGGCCTTTAATGTGTCCTTTCTCGAGAAAGGACACATTAAAGGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.2-3384s1c1
Sequence:CCGGGCAAAGAAATCTGCCTTGGAACTCGAGTTCCAAGGCAGATTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-349s1c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134013
VALIDATED
PSME4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) activator subunit 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134013.3-6010s1c1
Sequence:CCGGCTAGTACTATCATGGTATTATCTCGAGATAATACCATGATAGTACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-1249s1c1
Sequence:CCGGGCGTTGGCTGAACAAGTTAATCTCGAGATTAACTTGTTCAGCCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.3-2911s1c1
Sequence:CCGGGCACTTCCAAGGATCTCATAACTCGAGTTATGAGATCCTTGGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-436s21c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-638s21c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-1693s21c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134013.3-3415s21c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-147s1c1
Sequence:CCGGGCGGAAACTCTCCACTTATATCTCGAGATATAAGTGGAGAGTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-3126s1c1
Sequence:CCGGGCCATCAATAGTGAGACTATTCTCGAGAATAGTCTCACTATTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134013.2-1404s1c1
Sequence:CCGGCGACTTTAGTAAGTGCATGATCTCGAGATCATGCACTTACTAAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-507s1c1
Sequence:CCGGGCGGCCTTTAATGTGTCCTTTCTCGAGAAAGGACACATTAAAGGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134013.2-3384s1c1
Sequence:CCGGGCAAAGAAATCTGCCTTGGAACTCGAGTTCCAAGGCAGATTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134013.2-349s1c1
Sequence:CCGGCCACTTTATGACTTGGTAGAACTCGAGTTCTACCAAGTCATAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)