EMAIL THIS PAGE TO A FRIEND

PSMF1

proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

178 Gene Product Result for
Synonyms: PI31
UniProtKB ID: Q92530, A0AVQ9, D3DVW3, Q9H4I1
Gene ID:
Human(9491) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(228769) proteasome (prosome, macropain) inhibitor subunit 1
Rat(689852) proteasome (prosome, macropain) inhibitor subunit 1
Zebrafish(436820) proteasome (prosome, macropain) inhibitor subunit 1
chicken(430115) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
domestic cat(101101124) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
dog(477184) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
cow(617807) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
sheep(101120937) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
naked mole-rat(101699766) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
domestic guinea pig(100732045) proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0693 AQUA Peptide GGDDLDPNYVLSS[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_212446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006814 Rosetta Predictions human pricing
NM_178578 Rosetta Predictions human pricing
NM_178579 Rosetta Predictions human pricing
XR_006739 Rosetta Predictions rat pricing
NM_144889 Rosetta Predictions mouse pricing
NM_212446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342345 predicted 362
2 SASI_Hs02_00342346 predicted 493
3 SASI_Hs02_00342347 predicted 394
4 SASI_Hs02_00342348 predicted 472
5 SASI_Hs02_00342349 predicted 567
6 SASI_Hs02_00342350 predicted 592
7 SASI_Hs02_00342351 predicted 570
8 SASI_Hs02_00342352 predicted 433
9 SASI_Hs02_00342353 predicted 491
10 SASI_Hs01_00107676 predicted 1369
11 SASI_Hs01_00107673 predicted 1410
12 SASI_Hs01_00107674 predicted 819
13 SASI_Hs01_00107675 predicted 808
14 SASI_Hs01_00107677 predicted 1482
15 SASI_Hs01_00107678 predicted 1414
16 SASI_Hs01_00107679 predicted 1283
17 SASI_Hs01_00107680 predicted 1419
18 SASI_Hs01_00107681 predicted 1087
19 SASI_Hs01_00107682 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369823 predicted 349
2 SASI_Hs02_00369824 predicted 488
3 SASI_Hs02_00369825 predicted 386
4 SASI_Hs02_00369826 predicted 464
5 SASI_Hs02_00369827 predicted 559
6 SASI_Hs02_00369828 predicted 581
7 SASI_Hs02_00369829 predicted 555
8 SASI_Hs02_00369830 predicted 423
9 SASI_Hs02_00369831 predicted 478
10 SASI_Hs01_00144712 predicted 1354
11 SASI_Hs01_00144709 predicted 1381
12 SASI_Hs01_00144710 predicted 784
13 SASI_Hs01_00144711 predicted 774
14 SASI_Hs01_00144713 predicted 1455
15 SASI_Hs01_00144714 predicted 1385
16 SASI_Hs01_00144715 predicted 1244
17 SASI_Hs01_00144716 predicted 1383
18 SASI_Hs01_00144717 predicted 1048
19 SASI_Hs01_00144718 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102285 predicted 357
2 SASI_Hs01_00102286 predicted 738
3 SASI_Hs01_00102287 predicted 391
4 SASI_Hs01_00102288 predicted 721
5 SASI_Hs01_00102289 predicted 447
6 SASI_Hs01_00102290 predicted 484
7 SASI_Hs01_00102291 predicted 476
8 SASI_Hs01_00102292 predicted 441
9 SASI_Hs01_00102293 predicted 483
10 SASI_Hs01_00102294 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131501 predicted 795
2 SASI_Rn01_00131502 predicted 956
3 SASI_Rn02_00412714 predicted 780
4 SASI_Rn02_00412715 predicted 941
5 SASI_Rn02_00412716 predicted 899
6 SASI_Rn01_00131507 predicted 1061
7 SASI_Rn02_00412717 predicted 988
8 SASI_Rn02_00412718 predicted 961
9 SASI_Rn02_00412719 predicted 957
10 SASI_Rn01_00131509 predicted 958
11 SASI_Rn01_00131503 predicted 315
12 SASI_Rn01_00131504 predicted 1159
13 SASI_Rn01_00131505 predicted 207
14 SASI_Rn01_00131506 predicted 1165
15 SASI_Rn01_00131508 predicted 1163
16 SASI_Rn01_00131510 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142129 predicted 1139
2 SASI_Mm01_00142130 predicted 832
3 SASI_Mm01_00142131 predicted 946
4 SASI_Mm01_00142132 predicted 1218
5 SASI_Mm01_00142133 predicted 1210
6 SASI_Mm01_00142134 predicted 1194
7 SASI_Mm01_00142135 predicted 919
8 SASI_Mm01_00142136 predicted 1084
9 SASI_Mm01_00142137 predicted 1149
10 SASI_Mm01_00142138 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352261 predicted 1265
2 SASI_Mm01_00113771 predicted 1064
3 SASI_Mm02_00352262 predicted 474
4 SASI_Mm02_00352263 predicted 541
5 SASI_Mm02_00352264 predicted 296
6 SASI_Mm01_00113776 predicted 1157
7 SASI_Mm02_00352265 predicted 599
8 SASI_Mm02_00352266 predicted 575
9 SASI_Mm02_00352267 predicted 416
10 SASI_Mm02_00352268 predicted 489
11 SASI_Mm01_00113770 predicted 1371
12 SASI_Mm01_00113772 predicted 1178
13 SASI_Mm01_00113773 predicted 1457
14 SASI_Mm01_00113774 predicted 1445
15 SASI_Mm01_00113775 predicted 1425
16 SASI_Mm01_00113777 predicted 1321
17 SASI_Mm01_00113778 predicted 1387
18 SASI_Mm01_00113779 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006814
VALIDATED
PSMF1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-338s1c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-486s1c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-577s1c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-830s1c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-343s21c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-491s21c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-582s21c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-835s21c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006814
VALIDATED
PSMF1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-338s1c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-486s1c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-577s1c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-830s1c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-343s21c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-491s21c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-582s21c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-835s21c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006814
VALIDATED
PSMF1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-338s1c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-486s1c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-577s1c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006814.2-830s1c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-343s21c1
Sequence:CCGGGCTGGGTGGAACAACAATAAACTCGAGTTTATTGTTGTTCCACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-491s21c1
Sequence:CCGGCCCTGAACTTGGATGATTATACTCGAGTATAATCATCCAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-582s21c1
Sequence:CCGGGTCTGGAATCATCACACCTATCTCGAGATAGGTGTGATGATTCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006814.3-835s21c1
Sequence:CCGGGCACTTATTGACCCTTCCTCACTCGAGTGAGGAAGGGTCAATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144889
VALIDATED
PSMF1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-432s1c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-206s1c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-422s1c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-254s1c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-281s1c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144889
VALIDATED
PSMF1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-432s1c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-206s1c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-422s1c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-254s1c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-281s1c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144889
VALIDATED
PSMF1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-432s1c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-206s1c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144889.1-422s1c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-254s1c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144889.1-281s1c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212446
PSMF1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-468s21c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-458s21c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-317s21c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-290s21c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-242s21c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212446
PSMF1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-468s21c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-458s21c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-317s21c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-290s21c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-242s21c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212446
PSMF1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-468s21c1
Sequence:CCGGCCCTGAACTTAGATGATTATACTCGAGTATAATCATCTAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-458s21c1
Sequence:CCGGGCAGACTTGACCCTGAACTTACTCGAGTAAGTTCAGGGTCAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-317s21c1
Sequence:CCGGCCAGCTAAGTGGAACAGCAATCTCGAGATTGCTGTTCCACTTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-290s21c1
Sequence:CCGGCCCAGTGATAAGAAATCAGAACTCGAGTTCTGATTTCTTATCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212446.1-242s21c1
Sequence:CCGGGTGGTGACAAACGGCTACTATCTCGAGATAGTAGCCGTTTGTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)