EMAIL THIS PAGE TO A FRIEND

PSMG2

proteasome (prosome, macropain) assembly chaperone 2

69 Gene Product Result for
Synonyms: CLAST3 HCCA3 HsT1707 MDS003 PAC2 TNFSF5IP1
UniProtKB ID: Q969U7, B0YJB3, Q6IAH4
Gene ID:
Mouse(107047) proteasome (prosome, macropain) assembly chaperone 2
Rat(291539) proteasome (prosome, macropain) assembly chaperone 2
Zebrafish(573107) proteasome (prosome, macropain) assembly chaperone 2
chicken(421040) proteasome (prosome, macropain) assembly chaperone 2
domestic cat(101095201) proteasome (prosome, macropain) assembly chaperone 2
dog(480215) proteasome (prosome, macropain) assembly chaperone 2
cow(533993) proteasome (prosome, macropain) assembly chaperone 2
Goat(100861015) proteasome (prosome, macropain) assembly chaperone 2
naked mole-rat(101723846) proteasome (prosome, macropain) assembly chaperone 2
domestic guinea pig(100732915) proteasome (prosome, macropain) assembly chaperone 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020232 Rosetta Predictions human pricing
NM_001106138 Rosetta Predictions rat pricing
NM_134138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098042 predicted 778
2 SASI_Hs01_00098043 predicted 647
3 SASI_Hs01_00098044 predicted 282
4 SASI_Hs01_00098045 predicted 408
5 SASI_Hs01_00098046 predicted 684
6 SASI_Hs02_00353187 predicted 614
7 SASI_Hs01_00098047 predicted 785
8 SASI_Hs01_00098048 predicted 708
9 SASI_Hs01_00098049 predicted 394
10 SASI_Hs01_00098050 predicted 722
11 SASI_Hs01_00098051 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215998 predicted 267
2 SASI_Rn02_00215999 predicted 722
3 SASI_Rn02_00216000 predicted 834
4 SASI_Rn02_00216001 predicted 435
5 SASI_Rn02_00216002 predicted 210
6 SASI_Rn02_00216003 predicted 472
7 SASI_Rn02_00216004 predicted 752
8 SASI_Rn02_00216005 predicted 290
9 SASI_Rn02_00216006 predicted 584
10 SASI_Rn02_00216007 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158735 predicted 441
2 SASI_Mm01_00158736 predicted 474
3 SASI_Mm01_00158737 predicted 217
4 SASI_Mm01_00158738 predicted 749
5 SASI_Mm01_00158739 predicted 670
6 SASI_Mm01_00158740 predicted 303
7 SASI_Mm02_00339399 predicted 790
8 SASI_Mm01_00158741 predicted 326
9 SASI_Mm01_00158742 predicted 728
10 SASI_Mm01_00158743 predicted 201
11 SASI_Mm01_00158744 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020232
PSMG2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020232.3-880s1c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-692s1c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-725s1c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-412s1c1
Sequence:CCGGCAGTCATTCATATCAGCGTAACTCGAGTTACGCTGATATGAATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020232.3-302s1c1
Sequence:CCGGGCTCTACAGTTAAGATCCATTCTCGAGAATGGATCTTAACTGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020232.3-880s21c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-131s21c1
Sequence:CCGGCTTGCAATGGATCTGATTATTCTCGAGAATAATCAGATCCATTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-413s21c1
Sequence:CCGGAGTCATTCATATCAGCGTAATCTCGAGATTACGCTGATATGAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-692s21c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-725s21c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020232
PSMG2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020232.3-880s1c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-692s1c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-725s1c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-412s1c1
Sequence:CCGGCAGTCATTCATATCAGCGTAACTCGAGTTACGCTGATATGAATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020232.3-302s1c1
Sequence:CCGGGCTCTACAGTTAAGATCCATTCTCGAGAATGGATCTTAACTGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020232.3-880s21c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-131s21c1
Sequence:CCGGCTTGCAATGGATCTGATTATTCTCGAGAATAATCAGATCCATTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-413s21c1
Sequence:CCGGAGTCATTCATATCAGCGTAATCTCGAGATTACGCTGATATGAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-692s21c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-725s21c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020232
PSMG2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020232.3-880s1c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-692s1c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-725s1c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020232.3-412s1c1
Sequence:CCGGCAGTCATTCATATCAGCGTAACTCGAGTTACGCTGATATGAATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020232.3-302s1c1
Sequence:CCGGGCTCTACAGTTAAGATCCATTCTCGAGAATGGATCTTAACTGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020232.3-880s21c1
Sequence:CCGGCCAACACAGCTGTTAAACATTCTCGAGAATGTTTAACAGCTGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-131s21c1
Sequence:CCGGCTTGCAATGGATCTGATTATTCTCGAGAATAATCAGATCCATTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-413s21c1
Sequence:CCGGAGTCATTCATATCAGCGTAATCTCGAGATTACGCTGATATGAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-692s21c1
Sequence:CCGGGCATTAGGTCTTGTTGAGTATCTCGAGATACTCAACAAGACCTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020232.3-725s21c1
Sequence:CCGGCTTCAGATACTCAAACCACTTCTCGAGAAGTGGTTTGAGTATCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134138
VALIDATED
PSMG2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-341s1c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-427s1c1
Sequence:CCGGCCAGGATCATTGTTCTCTCAACTCGAGTTGAGAGAACAATGATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-500s1c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-453s1c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-894s1c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-341s21c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-453s21c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134138.1-894s21c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-200s1c1
Sequence:CCGGCATGTGTAAGATTGGTTATTTCTCGAGAAATAACCAATCTTACACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-168s1c1
Sequence:CCGGCTTGCAATAGATCTGATTATTCTCGAGAATAATCAGATCTATTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-765s1c1
Sequence:CCGGCAGATAATCAAACCCTGTAACCTCGAGGTTACAGGGTTTGATTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-500s21c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134138
VALIDATED
PSMG2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-341s1c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-427s1c1
Sequence:CCGGCCAGGATCATTGTTCTCTCAACTCGAGTTGAGAGAACAATGATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-500s1c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-453s1c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-894s1c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-341s21c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-453s21c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134138.1-894s21c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-200s1c1
Sequence:CCGGCATGTGTAAGATTGGTTATTTCTCGAGAAATAACCAATCTTACACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-168s1c1
Sequence:CCGGCTTGCAATAGATCTGATTATTCTCGAGAATAATCAGATCTATTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-765s1c1
Sequence:CCGGCAGATAATCAAACCCTGTAACCTCGAGGTTACAGGGTTTGATTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-500s21c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134138
VALIDATED
PSMG2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-341s1c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-427s1c1
Sequence:CCGGCCAGGATCATTGTTCTCTCAACTCGAGTTGAGAGAACAATGATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-500s1c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134138.1-453s1c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134138.1-894s1c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-341s21c1
Sequence:CCGGGCTTCAGTTAAGGTCCATCTTCTCGAGAAGATGGACCTTAACTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-453s21c1
Sequence:CCGGCATTCGTATCACCGCAACGATCTCGAGATCGTTGCGGTGATACGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134138.1-894s21c1
Sequence:CCGGCTCATCCTGCTGAGATCACAACTCGAGTTGTGATCTCAGCAGGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-200s1c1
Sequence:CCGGCATGTGTAAGATTGGTTATTTCTCGAGAAATAACCAATCTTACACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-168s1c1
Sequence:CCGGCTTGCAATAGATCTGATTATTCTCGAGAATAATCAGATCTATTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134138.1-765s1c1
Sequence:CCGGCAGATAATCAAACCCTGTAACCTCGAGGTTACAGGGTTTGATTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134138.1-500s21c1
Sequence:CCGGGTATCTGCTTACACCTTGTTTCTCGAGAAACAAGGTGTAAGCAGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)