EMAIL THIS PAGE TO A FRIEND

PSMG3

proteasome (prosome, macropain) assembly chaperone 3

33 Gene Product Result for
Synonyms: C7orf48 PAC3
UniProtKB ID: Q9BT73, A4D216, A8MPW2
Gene ID:
Mouse(66506) proteasome (prosome, macropain) assembly chaperone 3
Rat(100361517) proteasome (prosome, macropain) assembly chaperone 3
domestic guinea pig(100734999) proteasome (prosome, macropain) assembly chaperone 3
naked mole-rat(101709221) proteasome (prosome, macropain) assembly chaperone 3
cow(510741) proteasome (prosome, macropain) assembly chaperone 3
sheep(101119783) proteasome (prosome, macropain) assembly chaperone 3
Zebrafish(436802) proteasome (prosome, macropain) assembly chaperone 3
dog(479769) proteasome (prosome, macropain) assembly chaperone 3
chicken(416463) proteasome (prosome, macropain) assembly chaperone 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023876 Anti-PSMG3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2107537 Anti-PSMG3 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022891 MISSION® esiRNA esiRNA targeting mouse Psmg3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032302 Rosetta Predictions human pricing
NM_025604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070633 predicted 723
2 SASI_Hs01_00070634 predicted 891
3 SASI_Hs02_00359648 predicted 898
4 SASI_Hs01_00070635 predicted 1049
5 SASI_Hs01_00070636 predicted 862
6 SASI_Hs01_00070637 predicted 897
7 SASI_Hs01_00070638 predicted 903
8 SASI_Hs01_00070639 predicted 1159
9 SASI_Hs01_00070640 predicted 1151
10 SASI_Hs01_00070641 predicted 1070
11 SASI_Hs01_00070632 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083185 predicted 385
2 SASI_Mm01_00083186 predicted 591
3 SASI_Mm01_00083187 predicted 465
4 SASI_Mm01_00083188 predicted 370
5 SASI_Mm02_00328625 predicted 458
6 SASI_Mm01_00083189 predicted 603
7 SASI_Mm02_00328626 predicted 554
8 SASI_Mm01_00083191 predicted 287
9 SASI_Mm01_00083193 predicted 511
10 SASI_Mm01_00083194 predicted 434
11 SASI_Mm01_00083190 predicted 565
12 SASI_Mm01_00083192 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032302
PSMG3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1233s21c1
Sequence:CCGGGAGGAGTCGTGAATGGTTCTCCTCGAGGAGAACCATTCACGACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1182s21c1
Sequence:CCGGTCTGGTTACTAAGATCATCTGCTCGAGCAGATGATCTTAGTAACCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-719s21c1
Sequence:CCGGAGGTGGTGTGTACGGCCTTCACTCGAGTGAAGGCCGTACACACCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-869s21c1
Sequence:CCGGAGCCTCTCATCCATGTCTTTGCTCGAGCAAAGACATGGATGAGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-727s21c1
Sequence:CCGGTGTACGGCCTTCAGCAGTCACCTCGAGGTGACTGCTGAAGGCCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1160s21c1
Sequence:CCGGCGTGTCTCAGGCAGACTCTTACTCGAGTAAGAGTCTGCCTGAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-462s1c1
Sequence:CCGGGTCTTTGCAAAGAACCTGGTACTCGAGTACCAGGTTCTTTGCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032302.2-1174s1c1
Sequence:CCGGGACTCTTACTCTGGTTACTAACTCGAGTTAGTAACCAGAGTAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-483s1c1
Sequence:CCGGGCGTTTGTGTCTCAAGAAGCTCTCGAGAGCTTCTTGAGACACAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-347s1c1
Sequence:CCGGGTTTGGGAAGATGGGCACCCTCTCGAGAGGGTGCCCATCTTCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032302
PSMG3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1233s21c1
Sequence:CCGGGAGGAGTCGTGAATGGTTCTCCTCGAGGAGAACCATTCACGACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1182s21c1
Sequence:CCGGTCTGGTTACTAAGATCATCTGCTCGAGCAGATGATCTTAGTAACCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-719s21c1
Sequence:CCGGAGGTGGTGTGTACGGCCTTCACTCGAGTGAAGGCCGTACACACCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-869s21c1
Sequence:CCGGAGCCTCTCATCCATGTCTTTGCTCGAGCAAAGACATGGATGAGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-727s21c1
Sequence:CCGGTGTACGGCCTTCAGCAGTCACCTCGAGGTGACTGCTGAAGGCCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1160s21c1
Sequence:CCGGCGTGTCTCAGGCAGACTCTTACTCGAGTAAGAGTCTGCCTGAGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-462s1c1
Sequence:CCGGGTCTTTGCAAAGAACCTGGTACTCGAGTACCAGGTTCTTTGCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032302.2-1174s1c1
Sequence:CCGGGACTCTTACTCTGGTTACTAACTCGAGTTAGTAACCAGAGTAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-483s1c1
Sequence:CCGGGCGTTTGTGTCTCAAGAAGCTCTCGAGAGCTTCTTGAGACACAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-347s1c1
Sequence:CCGGGTTTGGGAAGATGGGCACCCTCTCGAGAGGGTGCCCATCTTCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032302
PSMG3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1233s21c1
Sequence:CCGGGAGGAGTCGTGAATGGTTCTCCTCGAGGAGAACCATTCACGACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1182s21c1
Sequence:CCGGTCTGGTTACTAAGATCATCTGCTCGAGCAGATGATCTTAGTAACCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-719s21c1
Sequence:CCGGAGGTGGTGTGTACGGCCTTCACTCGAGTGAAGGCCGTACACACCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-869s21c1
Sequence:CCGGAGCCTCTCATCCATGTCTTTGCTCGAGCAAAGACATGGATGAGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032302.3-727s21c1
Sequence:CCGGTGTACGGCCTTCAGCAGTCACCTCGAGGTGACTGCTGAAGGCCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032302.3-1160s21c1
Sequence:CCGGCGTGTCTCAGGCAGACTCTTACTCGAGTAAGAGTCTGCCTGAGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-462s1c1
Sequence:CCGGGTCTTTGCAAAGAACCTGGTACTCGAGTACCAGGTTCTTTGCAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032302.2-1174s1c1
Sequence:CCGGGACTCTTACTCTGGTTACTAACTCGAGTTAGTAACCAGAGTAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-483s1c1
Sequence:CCGGGCGTTTGTGTCTCAAGAAGCTCTCGAGAGCTTCTTGAGACACAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032302.1-347s1c1
Sequence:CCGGGTTTGGGAAGATGGGCACCCTCTCGAGAGGGTGCCCATCTTCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025604
VALIDATED
PSMG3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-379s1c1
Sequence:CCGGGCAAAGAACCTGGTAGCATTTCTCGAGAAATGCTACCAGGTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-391s1c1
Sequence:CCGGGTAGCATTTGTGTCGCAAGAACTCGAGTTCTTGCGACACAAATGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-438s1c1
Sequence:CCGGCATGGCTGTGAAAGACAAGAGCTCGAGCTCTTGTCTTTCACAGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-296s1c1
Sequence:CCGGGCAATGTGGCCAATGACATCACTCGAGTGATGTCATTGGCCACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-394s1c1
Sequence:CCGGGCATTTGTGTCGCAAGAAGCACTCGAGTGCTTCTTGCGACACAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025604
VALIDATED
PSMG3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-379s1c1
Sequence:CCGGGCAAAGAACCTGGTAGCATTTCTCGAGAAATGCTACCAGGTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-391s1c1
Sequence:CCGGGTAGCATTTGTGTCGCAAGAACTCGAGTTCTTGCGACACAAATGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-438s1c1
Sequence:CCGGCATGGCTGTGAAAGACAAGAGCTCGAGCTCTTGTCTTTCACAGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-296s1c1
Sequence:CCGGGCAATGTGGCCAATGACATCACTCGAGTGATGTCATTGGCCACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-394s1c1
Sequence:CCGGGCATTTGTGTCGCAAGAAGCACTCGAGTGCTTCTTGCGACACAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025604
VALIDATED
PSMG3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-379s1c1
Sequence:CCGGGCAAAGAACCTGGTAGCATTTCTCGAGAAATGCTACCAGGTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025604.1-391s1c1
Sequence:CCGGGTAGCATTTGTGTCGCAAGAACTCGAGTTCTTGCGACACAAATGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-438s1c1
Sequence:CCGGCATGGCTGTGAAAGACAAGAGCTCGAGCTCTTGTCTTTCACAGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-296s1c1
Sequence:CCGGGCAATGTGGCCAATGACATCACTCGAGTGATGTCATTGGCCACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025604.1-394s1c1
Sequence:CCGGGCATTTGTGTCGCAAGAAGCACTCGAGTGCTTCTTGCGACACAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)