EMAIL THIS PAGE TO A FRIEND

PSORS1C2

psoriasis susceptibility 1 candidate 2

49 Gene Product Result for
Synonyms: C6orf17 SPR1
UniProtKB ID: Q9UIG4, Q5STD0
Gene ID:
Mouse(57390) psoriasis susceptibility 1 candidate 2 (human)
Rat(686254) psoriasis susceptibility 1 candidate 2 (human)
dog(100682937) psoriasis susceptibility 1 candidate 2
domestic cat(101098223) psoriasis susceptibility 1 candidate 2
domestic guinea pig(100725223) psoriasis susceptibility 1 candidate 2
naked mole-rat(101725645) psoriasis susceptibility 1 candidate 2
cow(788684) psoriasis susceptibility 1 candidate 2
sheep(101109396) psoriasis susceptibility 1 candidate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057101 MISSION® esiRNA esiRNA targeting mouse Psors1c2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014069 Rosetta Predictions human pricing
XM_001073115 Rosetta Predictions rat pricing
NM_020576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012381 predicted 869
2 SASI_Hs02_00345099 predicted 880
3 SASI_Hs02_00345100 predicted 812
4 SASI_Hs01_00012382 predicted 804
5 SASI_Hs01_00012383 predicted 866
6 SASI_Hs01_00012384 predicted 866
7 SASI_Hs01_00012387 predicted 906
8 SASI_Hs01_00012389 predicted 581
9 SASI_Hs01_00012390 predicted 917
10 SASI_Hs02_00345101 predicted 814
11 SASI_Hs01_00012385 predicted 815
12 SASI_Hs01_00012386 predicted 808
13 SASI_Hs01_00012388 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341560 predicted 25
2 SASI_Rn02_00341561 predicted 18
3 SASI_Rn02_00341562 predicted 156
4 SASI_Rn02_00341563 predicted 196
5 SASI_Rn02_00341564 predicted 204
6 SASI_Rn02_00341565 predicted 24
7 SASI_Rn02_00341566 predicted 350
8 SASI_Rn02_00341567 predicted 26
9 SASI_Rn02_00341568 predicted 271
10 SASI_Rn02_00341569 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325641 predicted 465
2 SASI_Mm01_00065688 predicted 482
3 SASI_Mm01_00065689 predicted 438
4 SASI_Mm01_00065690 predicted 432
5 SASI_Mm01_00065691 predicted 479
6 SASI_Mm02_00325642 predicted 492
7 SASI_Mm01_00065692 predicted 488
8 SASI_Mm01_00065693 predicted 422
9 SASI_Mm01_00065695 predicted 440
10 SASI_Mm01_00065696 predicted 476
11 SASI_Mm01_00065694 predicted 487
12 SASI_Mm01_00065697 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014069
PSORS1C2 MISSION shRNA Bacterial Glycerol Stock
psoriasis susceptibility 1 candidate 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-952s21c1
Sequence:CCGGTGACAGCCTAAGCCTACTCTCCTCGAGGAGAGTAGGCTTAGGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-823s1c1
Sequence:CCGGCTCCTTAAACCTCTTCCTCATCTCGAGATGAGGAAGAGGTTTAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-817s1c1
Sequence:CCGGGCCTATCTCCTTAAACCTCTTCTCGAGAAGAGGTTTAAGGAGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014069.2-505s21c1
Sequence:CCGGTTTGAAGATCCTCCGCCTACCCTCGAGGGTAGGCGGAGGATCTTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-865s1c1
Sequence:CCGGCCGTAAGGTGGTGTTCTCAATCTCGAGATTGAGAACACCACCTTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-808s1c1
Sequence:CCGGCCCAATTTAGCCTATCTCCTTCTCGAGAAGGAGATAGGCTAAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-866s1c1
Sequence:CCGGCGTAAGGTGGTGTTCTCAATACTCGAGTATTGAGAACACCACCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-924s21c1
Sequence:CCGGTAGTCCTCACATCGCCCGTTTCTCGAGAAACGGGCGATGTGAGGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-821s21c1
Sequence:CCGGATTTAGCCTGTCTCCTTAAACCTCGAGGTTTAAGGAGACAGGCTAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014069
PSORS1C2 MISSION shRNA shRNA Plasmid DNA
psoriasis susceptibility 1 candidate 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-952s21c1
Sequence:CCGGTGACAGCCTAAGCCTACTCTCCTCGAGGAGAGTAGGCTTAGGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-823s1c1
Sequence:CCGGCTCCTTAAACCTCTTCCTCATCTCGAGATGAGGAAGAGGTTTAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-817s1c1
Sequence:CCGGGCCTATCTCCTTAAACCTCTTCTCGAGAAGAGGTTTAAGGAGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014069.2-505s21c1
Sequence:CCGGTTTGAAGATCCTCCGCCTACCCTCGAGGGTAGGCGGAGGATCTTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-865s1c1
Sequence:CCGGCCGTAAGGTGGTGTTCTCAATCTCGAGATTGAGAACACCACCTTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-808s1c1
Sequence:CCGGCCCAATTTAGCCTATCTCCTTCTCGAGAAGGAGATAGGCTAAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-866s1c1
Sequence:CCGGCGTAAGGTGGTGTTCTCAATACTCGAGTATTGAGAACACCACCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-924s21c1
Sequence:CCGGTAGTCCTCACATCGCCCGTTTCTCGAGAAACGGGCGATGTGAGGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-821s21c1
Sequence:CCGGATTTAGCCTGTCTCCTTAAACCTCGAGGTTTAAGGAGACAGGCTAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014069
PSORS1C2 MISSION shRNA Lentiviral Transduction Particles
psoriasis susceptibility 1 candidate 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-952s21c1
Sequence:CCGGTGACAGCCTAAGCCTACTCTCCTCGAGGAGAGTAGGCTTAGGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-823s1c1
Sequence:CCGGCTCCTTAAACCTCTTCCTCATCTCGAGATGAGGAAGAGGTTTAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-817s1c1
Sequence:CCGGGCCTATCTCCTTAAACCTCTTCTCGAGAAGAGGTTTAAGGAGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014069.2-505s21c1
Sequence:CCGGTTTGAAGATCCTCCGCCTACCCTCGAGGGTAGGCGGAGGATCTTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-865s1c1
Sequence:CCGGCCGTAAGGTGGTGTTCTCAATCTCGAGATTGAGAACACCACCTTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-808s1c1
Sequence:CCGGCCCAATTTAGCCTATCTCCTTCTCGAGAAGGAGATAGGCTAAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014069.1-866s1c1
Sequence:CCGGCGTAAGGTGGTGTTCTCAATACTCGAGTATTGAGAACACCACCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-924s21c1
Sequence:CCGGTAGTCCTCACATCGCCCGTTTCTCGAGAAACGGGCGATGTGAGGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014069.2-821s21c1
Sequence:CCGGATTTAGCCTGTCTCCTTAAACCTCGAGGTTTAAGGAGACAGGCTAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020576
VALIDATED
PSORS1C2 MISSION shRNA Bacterial Glycerol Stock
psoriasis susceptibility 1 candidate 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020576.1-317s1c1
Sequence:CCGGGAGATGGACCATGAATCTCAGCTCGAGCTGAGATTCATGGTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-438s1c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-490s1c1
Sequence:CCGGCTCTGTTTGAATTGTGTTCTACTCGAGTAGAACACAATTCAAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-143s1c1
Sequence:CCGGCCTTTGTTTGATGAACCTCCGCTCGAGCGGAGGTTCATCAAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-561s1c1
Sequence:CCGGCCTGTTCAGTCATTATGTTGTCTCGAGACAACATAATGACTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020576.1-244s21c1
Sequence:CCGGTAAACCTCCTCTGCCTGATGACTCGAGTCATCAGGCAGAGGAGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-438s21c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-360s21c1
Sequence:CCGGCCCAGGAAGAGTATAGATAGGCTCGAGCCTATCTATACTCTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-588s21c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-177s21c1
Sequence:CCGGACCGTCCCTGGAGAGATCTTCCTCGAGGAAGATCTCTCCAGGGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-314s1c1
Sequence:CCGGCCTGAGATGGACCATGAATCTCTCGAGAGATTCATGGTCCATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-588s1c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020576
VALIDATED
PSORS1C2 MISSION shRNA shRNA Plasmid DNA
psoriasis susceptibility 1 candidate 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020576.1-317s1c1
Sequence:CCGGGAGATGGACCATGAATCTCAGCTCGAGCTGAGATTCATGGTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-438s1c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-490s1c1
Sequence:CCGGCTCTGTTTGAATTGTGTTCTACTCGAGTAGAACACAATTCAAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-143s1c1
Sequence:CCGGCCTTTGTTTGATGAACCTCCGCTCGAGCGGAGGTTCATCAAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-561s1c1
Sequence:CCGGCCTGTTCAGTCATTATGTTGTCTCGAGACAACATAATGACTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020576.1-244s21c1
Sequence:CCGGTAAACCTCCTCTGCCTGATGACTCGAGTCATCAGGCAGAGGAGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-438s21c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-360s21c1
Sequence:CCGGCCCAGGAAGAGTATAGATAGGCTCGAGCCTATCTATACTCTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-588s21c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-177s21c1
Sequence:CCGGACCGTCCCTGGAGAGATCTTCCTCGAGGAAGATCTCTCCAGGGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-314s1c1
Sequence:CCGGCCTGAGATGGACCATGAATCTCTCGAGAGATTCATGGTCCATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-588s1c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020576
VALIDATED
PSORS1C2 MISSION shRNA Lentiviral Transduction Particles
psoriasis susceptibility 1 candidate 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020576.1-317s1c1
Sequence:CCGGGAGATGGACCATGAATCTCAGCTCGAGCTGAGATTCATGGTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-438s1c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-490s1c1
Sequence:CCGGCTCTGTTTGAATTGTGTTCTACTCGAGTAGAACACAATTCAAACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-143s1c1
Sequence:CCGGCCTTTGTTTGATGAACCTCCGCTCGAGCGGAGGTTCATCAAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020576.1-561s1c1
Sequence:CCGGCCTGTTCAGTCATTATGTTGTCTCGAGACAACATAATGACTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020576.1-244s21c1
Sequence:CCGGTAAACCTCCTCTGCCTGATGACTCGAGTCATCAGGCAGAGGAGGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-438s21c1
Sequence:CCGGCTGCCCGCTTAGAATCTCAATCTCGAGATTGAGATTCTAAGCGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-360s21c1
Sequence:CCGGCCCAGGAAGAGTATAGATAGGCTCGAGCCTATCTATACTCTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-588s21c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020576.1-177s21c1
Sequence:CCGGACCGTCCCTGGAGAGATCTTCCTCGAGGAAGATCTCTCCAGGGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-314s1c1
Sequence:CCGGCCTGAGATGGACCATGAATCTCTCGAGAGATTCATGGTCCATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020576.1-588s1c1
Sequence:CCGGGCTTCTCTTGATCAGCAGAAACTCGAGTTTCTGCTGATCAAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)