EMAIL THIS PAGE TO A FRIEND

PSPH

phosphoserine phosphatase

75 Gene Product Result for
Synonyms: PSP PSPHD
UniProtKB ID: P78330, B2RCR5, Q7Z3S5
Gene ID:
Human(5723) Summary: The protein encoded by this gene belongs to a subfamily of the phosphotransferases. This encoded enzyme is responsible for the third and last step in L-serine formation. It catalyzes magnesium-dependent hydrolysis of L-phosphoserine and is also involved in an exchange reaction between L-serine and L-phosphoserine. Deficiency of this protein is thought to be linked to Williams syndrome. [provided by RefSeq, Jul 2008]
Mouse(100678) phosphoserine phosphatase
Rat(304429) phosphoserine phosphatase
Zebrafish(606663) phosphoserine phosphatase
chicken(417540) phosphoserine phosphatase
dog(489783) phosphoserine phosphatase
domestic cat(101082200) phosphoserine phosphatase
domestic guinea pig(100719583) phosphoserine phosphatase
naked mole-rat(101703536) phosphoserine phosphatase
cow(533630) phosphoserine phosphatase
sheep(100145875) phosphoserine phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501244 Anti-PSPH (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1406330 Anti-PSPH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411971 ANTI-PSPH antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA020376 Anti-PSPH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA029515 Anti-PSPH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104894 Anti-PSPH antibody produced in rabbit affinity isolated antibody rat, rabbit, bovine, dog, mouse, human, horse, pig, sheep
western blot pricing
SAB2104895 Anti-PSPH antibody produced in rabbit affinity isolated antibody dog, rat, mouse, rabbit, bovine, horse, sheep, human, guinea pig
western blot pricing
WH0005723M2 Monoclonal Anti-PSPH antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404270 Monoclonal Anti-PSPH antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004577 siRNAs that have been validated in the lab human pricing
NM_001009679 Rosetta Predictions rat pricing
NM_133900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004577 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156219 validated 1252
2 SASI_Hs02_00337914 predicted 1057
3 SASI_Hs02_00337915 predicted 1010
4 SASI_Hs02_00337916 predicted 1038
5 SASI_Hs02_00337917 predicted 1095
6 SASI_Hs01_00156220 predicted 1130
7 SASI_Hs02_00337918 predicted 1043
8 SASI_Hs01_00156221 predicted 841
9 SASI_Hs01_00156222 predicted 805
10 SASI_Hs02_00337919 predicted 1118
11 SASI_Hs01_00156223 predicted 1147
12 SASI_Hs01_00156224 predicted 993
13 SASI_Hs01_00156225 predicted 1263
14 SASI_Hs01_00156226 predicted 1179
15 SASI_Hs01_00156227 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031851 predicted 266
2 SASI_Rn01_00031852 predicted 862
3 SASI_Rn01_00031853 predicted 274
4 SASI_Rn01_00031854 predicted 303
5 SASI_Rn01_00031855 predicted 827
6 SASI_Rn01_00031856 predicted 252
7 SASI_Rn01_00031857 predicted 535
8 SASI_Rn01_00031858 predicted 819
9 SASI_Rn01_00031860 predicted 620
10 SASI_Rn02_00199718 predicted 582
11 SASI_Rn01_00031859 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338954 predicted 943
2 SASI_Mm01_00180115 predicted 1246
3 SASI_Mm01_00180116 predicted 824
4 SASI_Mm01_00180118 predicted 603
5 SASI_Mm01_00180119 predicted 1199
6 SASI_Mm01_00180120 predicted 1172
7 SASI_Mm01_00180121 predicted 649
8 SASI_Mm01_00180122 predicted 824
9 SASI_Mm01_00180123 predicted 980
10 SASI_Mm01_00180124 predicted 930
11 SASI_Mm01_00180117 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004577
VALIDATED
PSPH MISSION shRNA Bacterial Glycerol Stock
phosphoserine phosphatase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-344s1c1
Sequence:CCGGTCTGGTGGCTTTAGGAGTATTCTCGAGAATACTCCTAAAGCCACCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1260s21c1
Sequence:GTACCGGTGGAGATGGTGCCACAGATATCTCGAGATATCTGTGGCACCATCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004577.x-1389s1c1
Sequence:CCGGGTCAGAACGGATTTGTGGAAACTCGAGTTTCCACAAATCCGTTCTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004577.x-391s1c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1578s21c1
Sequence:GTACCGGTTAACTGTAGTTCCAGTATTACTCGAGTAATACTGGAACTACAGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-356s1c1
Sequence:CCGGAGGAGTATTGTAGAGCATGTTCTCGAGAACATGCTCTACAATACTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-386s1c1
Sequence:CCGGCTCAATATCCCAGCAACCAATCTCGAGATTGGTTGCTGGGATATTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1015s21c1
Sequence:CCGGAGTCGCCTACAGGAGCGAAATCTCGAGATTTCGCTCCTGTAGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1475s21c1
Sequence:CCGGTTGCTTACAGTTGCCTATTACCTCGAGGTAATAGGCAACTGTAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1101s21c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1341s21c1
Sequence:CCGGAGTCAAGGATAACGCCAAATGCTCGAGCATTTGGCGTTATCCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1137s21c1
Sequence:CCGGATTCTACTTTAACGGTGAATACTCGAGTATTCACCGTTAAAGTAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004577
VALIDATED
PSPH MISSION shRNA shRNA Plasmid DNA
phosphoserine phosphatase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-344s1c1
Sequence:CCGGTCTGGTGGCTTTAGGAGTATTCTCGAGAATACTCCTAAAGCCACCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1260s21c1
Sequence:GTACCGGTGGAGATGGTGCCACAGATATCTCGAGATATCTGTGGCACCATCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004577.x-1389s1c1
Sequence:CCGGGTCAGAACGGATTTGTGGAAACTCGAGTTTCCACAAATCCGTTCTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004577.x-391s1c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1578s21c1
Sequence:GTACCGGTTAACTGTAGTTCCAGTATTACTCGAGTAATACTGGAACTACAGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-356s1c1
Sequence:CCGGAGGAGTATTGTAGAGCATGTTCTCGAGAACATGCTCTACAATACTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-386s1c1
Sequence:CCGGCTCAATATCCCAGCAACCAATCTCGAGATTGGTTGCTGGGATATTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1015s21c1
Sequence:CCGGAGTCGCCTACAGGAGCGAAATCTCGAGATTTCGCTCCTGTAGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1475s21c1
Sequence:CCGGTTGCTTACAGTTGCCTATTACCTCGAGGTAATAGGCAACTGTAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1101s21c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1341s21c1
Sequence:CCGGAGTCAAGGATAACGCCAAATGCTCGAGCATTTGGCGTTATCCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1137s21c1
Sequence:CCGGATTCTACTTTAACGGTGAATACTCGAGTATTCACCGTTAAAGTAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004577
VALIDATED
PSPH MISSION shRNA Lentiviral Transduction Particles
phosphoserine phosphatase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-344s1c1
Sequence:CCGGTCTGGTGGCTTTAGGAGTATTCTCGAGAATACTCCTAAAGCCACCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1260s21c1
Sequence:GTACCGGTGGAGATGGTGCCACAGATATCTCGAGATATCTGTGGCACCATCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004577.x-1389s1c1
Sequence:CCGGGTCAGAACGGATTTGTGGAAACTCGAGTTTCCACAAATCCGTTCTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004577.x-391s1c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1578s21c1
Sequence:GTACCGGTTAACTGTAGTTCCAGTATTACTCGAGTAATACTGGAACTACAGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-356s1c1
Sequence:CCGGAGGAGTATTGTAGAGCATGTTCTCGAGAACATGCTCTACAATACTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004577.x-386s1c1
Sequence:CCGGCTCAATATCCCAGCAACCAATCTCGAGATTGGTTGCTGGGATATTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1015s21c1
Sequence:CCGGAGTCGCCTACAGGAGCGAAATCTCGAGATTTCGCTCCTGTAGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1475s21c1
Sequence:CCGGTTGCTTACAGTTGCCTATTACCTCGAGGTAATAGGCAACTGTAAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1101s21c1
Sequence:CCGGTATCCCAGCAACCAATGTATTCTCGAGAATACATTGGTTGCTGGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1341s21c1
Sequence:CCGGAGTCAAGGATAACGCCAAATGCTCGAGCATTTGGCGTTATCCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004577.3-1137s21c1
Sequence:CCGGATTCTACTTTAACGGTGAATACTCGAGTATTCACCGTTAAAGTAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133900
VALIDATED
PSPH MISSION shRNA Bacterial Glycerol Stock
phosphoserine phosphatase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-624s1c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-975s21c1
Sequence:CCGGATAGGCTGAAGTTCTACTTTACTCGAGTAAAGTAGAACTTCAGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-1289s1c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-932s1c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-968s1c1
Sequence:CCGGGTTTGCCAATAGGCTGAAGTTCTCGAGAACTTCAGCCTATTGGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-940s1c1
Sequence:CCGGCAAAGCTCAATATCCCAACAACTCGAGTTGTTGGGATATTGAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133900.3-1288s21c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-623s21c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-668s21c1
Sequence:CCGGATCGATGAGCTGGCCAAATTCCTCGAGGAATTTGGCCAGCTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-931s21c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133900
VALIDATED
PSPH MISSION shRNA shRNA Plasmid DNA
phosphoserine phosphatase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-624s1c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-975s21c1
Sequence:CCGGATAGGCTGAAGTTCTACTTTACTCGAGTAAAGTAGAACTTCAGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-1289s1c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-932s1c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-968s1c1
Sequence:CCGGGTTTGCCAATAGGCTGAAGTTCTCGAGAACTTCAGCCTATTGGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-940s1c1
Sequence:CCGGCAAAGCTCAATATCCCAACAACTCGAGTTGTTGGGATATTGAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133900.3-1288s21c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-623s21c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-668s21c1
Sequence:CCGGATCGATGAGCTGGCCAAATTCCTCGAGGAATTTGGCCAGCTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-931s21c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133900
VALIDATED
PSPH MISSION shRNA Lentiviral Transduction Particles
phosphoserine phosphatase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-624s1c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-975s21c1
Sequence:CCGGATAGGCTGAAGTTCTACTTTACTCGAGTAAAGTAGAACTTCAGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-1289s1c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133900.2-932s1c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-968s1c1
Sequence:CCGGGTTTGCCAATAGGCTGAAGTTCTCGAGAACTTCAGCCTATTGGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133900.2-940s1c1
Sequence:CCGGCAAAGCTCAATATCCCAACAACTCGAGTTGTTGGGATATTGAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133900.3-1288s21c1
Sequence:CCGGCCTTCTCAAAGCCACACAGTTCTCGAGAACTGTGTGGCTTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-623s21c1
Sequence:CCGGGCAGTGTGCTTTGATGTTGATCTCGAGATCAACATCAAAGCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-668s21c1
Sequence:CCGGATCGATGAGCTGGCCAAATTCCTCGAGGAATTTGGCCAGCTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133900.3-931s21c1
Sequence:CCGGCGTTGCTGCAAAGCTCAATATCTCGAGATATTGAGCTTTGCAGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)