EMAIL THIS PAGE TO A FRIEND

PSRC1

proline/serine-rich coiled-coil 1

121 Gene Product Result for
Synonyms: DDA3 FP3214
UniProtKB ID: Q6PGN9, Q5T2Z3, Q6ZTI8, Q71MG3, Q9BV77
Gene ID:
Human(84722) Summary: This gene encodes a proline-rich protein. Studies of this gene and the related mouse gene suggest that this gene is regulated by p53 and may participate in p53-mediated growth suppression. The encoded protein may function as a microtubule destabilizing protein that controls spindle dynamics and mitotic progression by recruiting and regulating microtubule depolymerases. At least one genetic variation in this gene has been associated with decreased serum levels of low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
Mouse(56742) proline/serine-rich coiled-coil 1
Rat(691380) proline/serine-rich coiled-coil 1
domestic cat(101098561) proline/serine-rich coiled-coil 1
dog(611844) proline/serine-rich coiled-coil 1
domestic guinea pig(100717233) proline/serine-rich coiled-coil 1
naked mole-rat(101696892) proline/serine-rich coiled-coil 1
cow(541250) proline/serine-rich coiled-coil 1
sheep(101103854) proline/serine-rich coiled-coil 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005290 Rosetta Predictions human pricing
NM_001032290 Rosetta Predictions human pricing
NM_001032291 Rosetta Predictions human pricing
NM_032636 Rosetta Predictions human pricing
NM_001044302 Rosetta Predictions rat pricing
NM_019976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176961 predicted 1293
2 SASI_Hs01_00176962 predicted 1034
3 SASI_Hs01_00176963 predicted 1245
4 SASI_Hs01_00176964 predicted 1005
5 SASI_Hs01_00176965 predicted 1362
6 SASI_Hs01_00176966 predicted 1021
7 SASI_Hs02_00304837 predicted 1249
8 SASI_Hs01_00176967 predicted 1162
9 SASI_Hs01_00176968 predicted 1255
10 SASI_Hs01_00176969 predicted 461
11 SASI_Hs01_00176960 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199167 predicted 1482
2 SASI_Hs01_00199168 predicted 1228
3 SASI_Hs01_00199169 predicted 1446
4 SASI_Hs01_00199170 predicted 1198
5 SASI_Hs01_00199171 predicted 1555
6 SASI_Hs01_00199172 predicted 1213
7 SASI_Hs02_00307875 predicted 1448
8 SASI_Hs01_00199173 predicted 1353
9 SASI_Hs01_00199174 predicted 1444
10 SASI_Hs01_00199175 predicted 464
11 SASI_Hs01_00199166 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075990 predicted 1394
2 SASI_Hs01_00075991 predicted 1132
3 SASI_Hs01_00075992 predicted 1355
4 SASI_Hs01_00075993 predicted 1108
5 SASI_Hs01_00075994 predicted 1464
6 SASI_Hs01_00075995 predicted 1117
7 SASI_Hs02_00307876 predicted 1358
8 SASI_Hs01_00075996 predicted 1260
9 SASI_Hs01_00075997 predicted 1354
10 SASI_Hs01_00075998 predicted 459
11 SASI_Hs01_00075989 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171120 predicted 1388
2 SASI_Hs01_00171121 predicted 1134
3 SASI_Hs01_00171122 predicted 1353
4 SASI_Hs01_00171123 predicted 1103
5 SASI_Hs01_00171124 predicted 1459
6 SASI_Hs01_00171125 predicted 1121
7 SASI_Hs02_00360189 predicted 1353
8 SASI_Hs01_00171126 predicted 1259
9 SASI_Hs01_00171127 predicted 1354
10 SASI_Hs01_00171128 predicted 459
11 SASI_Hs01_00171119 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205684 predicted 584
2 SASI_Rn02_00205685 predicted 856
3 SASI_Rn02_00205686 predicted 1404
4 SASI_Rn02_00205687 predicted 565
5 SASI_Rn02_00205688 predicted 556
6 SASI_Rn02_00205689 predicted 1144
7 SASI_Rn02_00205690 predicted 334
8 SASI_Rn02_00205691 predicted 939
9 SASI_Rn02_00205692 predicted 288
10 SASI_Rn02_00205693 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072640 predicted 206
2 SASI_Mm01_00072641 predicted 1384
3 SASI_Mm01_00072642 predicted 1343
4 SASI_Mm01_00072643 predicted 1139
5 SASI_Mm01_00072644 predicted 624
6 SASI_Mm01_00072645 predicted 752
7 SASI_Mm01_00072646 predicted 600
8 SASI_Mm01_00072647 predicted 673
9 SASI_Mm01_00072648 predicted 338
10 SASI_Mm01_00072649 predicted 1295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032636
VALIDATED
PSRC1 MISSION shRNA Bacterial Glycerol Stock
proline/serine-rich coiled-coil 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1103s21c1
Sequence:CCGGTCCCAGGACCTACCAGGTAAACTCGAGTTTACCTGGTAGGTCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-259s21c1
Sequence:CCGGTCCCACCGAAGTGACCCAAATCTCGAGATTTGGGTCACTTCGGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1026s21c1
Sequence:CCGGTCCTGTTTCCCAGCGACTAAACTCGAGTTTAGTCGCTGGGAAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032636.6-558s21c1
Sequence:CCGGTCGACTCCGGAGTAATGATAGCTCGAGCTATCATTACTCCGGAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1469s21c1
Sequence:CCGGGCATTGGTTCACTGGACATTTCTCGAGAAATGTCCAGTGAACCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-1036s1c1
Sequence:CCGGGCGACTAAATCTTCCTGTCATCTCGAGATGACAGGAAGATTTAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-836s1c1
Sequence:CCGGGCTGCTAAATCTTCCAGTCAACTCGAGTTGACTGGAAGATTTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032636
VALIDATED
PSRC1 MISSION shRNA shRNA Plasmid DNA
proline/serine-rich coiled-coil 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1103s21c1
Sequence:CCGGTCCCAGGACCTACCAGGTAAACTCGAGTTTACCTGGTAGGTCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-259s21c1
Sequence:CCGGTCCCACCGAAGTGACCCAAATCTCGAGATTTGGGTCACTTCGGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1026s21c1
Sequence:CCGGTCCTGTTTCCCAGCGACTAAACTCGAGTTTAGTCGCTGGGAAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032636.6-558s21c1
Sequence:CCGGTCGACTCCGGAGTAATGATAGCTCGAGCTATCATTACTCCGGAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1469s21c1
Sequence:CCGGGCATTGGTTCACTGGACATTTCTCGAGAAATGTCCAGTGAACCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-1036s1c1
Sequence:CCGGGCGACTAAATCTTCCTGTCATCTCGAGATGACAGGAAGATTTAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-836s1c1
Sequence:CCGGGCTGCTAAATCTTCCAGTCAACTCGAGTTGACTGGAAGATTTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032636
VALIDATED
PSRC1 MISSION shRNA Lentiviral Transduction Particles
proline/serine-rich coiled-coil 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1103s21c1
Sequence:CCGGTCCCAGGACCTACCAGGTAAACTCGAGTTTACCTGGTAGGTCCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-259s21c1
Sequence:CCGGTCCCACCGAAGTGACCCAAATCTCGAGATTTGGGTCACTTCGGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1026s21c1
Sequence:CCGGTCCTGTTTCCCAGCGACTAAACTCGAGTTTAGTCGCTGGGAAACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032636.6-558s21c1
Sequence:CCGGTCGACTCCGGAGTAATGATAGCTCGAGCTATCATTACTCCGGAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032636.6-1469s21c1
Sequence:CCGGGCATTGGTTCACTGGACATTTCTCGAGAAATGTCCAGTGAACCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-1036s1c1
Sequence:CCGGGCGACTAAATCTTCCTGTCATCTCGAGATGACAGGAAGATTTAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032636.4-836s1c1
Sequence:CCGGGCTGCTAAATCTTCCAGTCAACTCGAGTTGACTGGAAGATTTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019976
VALIDATED
PSRC1 MISSION shRNA Bacterial Glycerol Stock
proline/serine-rich coiled-coil 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-615s1c1
Sequence:CCGGCCTCCAGCATAAAGAAGGAATCTCGAGATTCCTTCTTTATGCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019976.1-214s1c1
Sequence:CCGGAGTATTAGTGAGTCCAGAGAACTCGAGTTCTCTGGACTCACTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-198s1c1
Sequence:CCGGAGGAAGAAGACATAACAGTATCTCGAGATACTGTTATGTCTTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-257s1c1
Sequence:CCGGCATCGGAGTAACCCAAATGAACTCGAGTTCATTTGGGTTACTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-898s1c1
Sequence:CCGGGCGGAGTCTACCACCTGGAAACTCGAGTTTCCAGGTGGTAGACTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019976
VALIDATED
PSRC1 MISSION shRNA shRNA Plasmid DNA
proline/serine-rich coiled-coil 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-615s1c1
Sequence:CCGGCCTCCAGCATAAAGAAGGAATCTCGAGATTCCTTCTTTATGCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019976.1-214s1c1
Sequence:CCGGAGTATTAGTGAGTCCAGAGAACTCGAGTTCTCTGGACTCACTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-198s1c1
Sequence:CCGGAGGAAGAAGACATAACAGTATCTCGAGATACTGTTATGTCTTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-257s1c1
Sequence:CCGGCATCGGAGTAACCCAAATGAACTCGAGTTCATTTGGGTTACTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-898s1c1
Sequence:CCGGGCGGAGTCTACCACCTGGAAACTCGAGTTTCCAGGTGGTAGACTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019976
VALIDATED
PSRC1 MISSION shRNA Lentiviral Transduction Particles
proline/serine-rich coiled-coil 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-615s1c1
Sequence:CCGGCCTCCAGCATAAAGAAGGAATCTCGAGATTCCTTCTTTATGCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019976.1-214s1c1
Sequence:CCGGAGTATTAGTGAGTCCAGAGAACTCGAGTTCTCTGGACTCACTAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-198s1c1
Sequence:CCGGAGGAAGAAGACATAACAGTATCTCGAGATACTGTTATGTCTTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-257s1c1
Sequence:CCGGCATCGGAGTAACCCAAATGAACTCGAGTTCATTTGGGTTACTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019976.1-898s1c1
Sequence:CCGGGCGGAGTCTACCACCTGGAAACTCGAGTTTCCAGGTGGTAGACTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)