EMAIL THIS PAGE TO A FRIEND

PSTPIP2

proline-serine-threonine phosphatase interacting protein 2

166 Gene Product Result for
Synonyms: MAYP
UniProtKB ID: Q9H939
Gene ID:
Mouse(19201) proline-serine-threonine phosphatase-interacting protein 2
Rat(307248) proline-serine-threonine phosphatase-interacting protein 2
chicken(770399) proline-serine-threonine phosphatase interacting protein 2
domestic cat(101085158) proline-serine-threonine phosphatase interacting protein 2
dog(480150) proline-serine-threonine phosphatase interacting protein 2
cow(523223) proline-serine-threonine phosphatase interacting protein 2
sheep(101111145) proline-serine-threonine phosphatase interacting protein 2
naked mole-rat(101705064) proline-serine-threonine phosphatase interacting protein 2
domestic guinea pig(100727049) proline-serine-threonine phosphatase interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024430 Rosetta Predictions human pricing
XM_001056422 Rosetta Predictions rat pricing
XM_225698 Rosetta Predictions rat pricing
NM_013831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356750 predicted 364
2 SASI_Hs01_00194483 predicted 1076
3 SASI_Hs01_00194484 predicted 525
4 SASI_Hs02_00356751 predicted 873
5 SASI_Hs02_00356752 predicted 834
6 SASI_Hs02_00356753 predicted 820
7 SASI_Hs01_00194486 predicted 759
8 SASI_Hs01_00194487 predicted 778
9 SASI_Hs01_00194488 predicted 735
10 SASI_Hs01_00194489 predicted 251
11 SASI_Hs01_00194485 predicted 818
12 SASI_Hs01_00194490 predicted 441
13 SASI_Hs01_00194491 predicted 1077
14 SASI_Hs01_00194492 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283238 predicted 363
2 SASI_Rn02_00283239 predicted 397
3 SASI_Rn02_00283240 predicted 1074
4 SASI_Rn02_00283241 predicted 917
5 SASI_Rn02_00283242 predicted 759
6 SASI_Rn02_00283243 predicted 946
7 SASI_Rn02_00283244 predicted 326
8 SASI_Rn02_00283245 predicted 512
9 SASI_Rn02_00283246 predicted 805
10 SASI_Rn02_00283247 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383064 predicted 209
2 SASI_Rn02_00383065 predicted 207
3 SASI_Rn02_00383066 predicted 205
4 SASI_Rn02_00383067 predicted 215
5 SASI_Rn02_00383068 predicted 223
6 SASI_Rn02_00383069 predicted 11
7 SASI_Rn02_00383070 predicted 313
8 SASI_Rn02_00383071 predicted 1228
9 SASI_Rn02_00383072 predicted 836
10 SASI_Rn02_00383073 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073396 predicted 226
2 SASI_Mm01_00073397 predicted 681
3 SASI_Mm01_00073398 predicted 827
4 SASI_Mm01_00073399 predicted 890
5 SASI_Mm01_00073400 predicted 436
6 SASI_Mm01_00073401 predicted 255
7 SASI_Mm01_00073402 predicted 736
8 SASI_Mm01_00073403 predicted 881
9 SASI_Mm01_00073404 predicted 325
10 SASI_Mm01_00073405 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024430
VALIDATED
PSTPIP2 MISSION shRNA Bacterial Glycerol Stock
proline-serine-threonine phosphatase interacting protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-562s1c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-340s1c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024430.x-1393s1c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-214s1c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024430.x-943s1c1
Sequence:CCGGCTTTGGTTGATGACTACAGTTCTCGAGAACTGTAGTCATCAACCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-589s21c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-367s21c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024430.3-1517s21c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-241s21c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024430
VALIDATED
PSTPIP2 MISSION shRNA shRNA Plasmid DNA
proline-serine-threonine phosphatase interacting protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-562s1c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-340s1c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024430.x-1393s1c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-214s1c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024430.x-943s1c1
Sequence:CCGGCTTTGGTTGATGACTACAGTTCTCGAGAACTGTAGTCATCAACCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-589s21c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-367s21c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024430.3-1517s21c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-241s21c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024430
VALIDATED
PSTPIP2 MISSION shRNA Lentiviral Transduction Particles
proline-serine-threonine phosphatase interacting protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-562s1c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-340s1c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024430.x-1393s1c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024430.x-214s1c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024430.x-943s1c1
Sequence:CCGGCTTTGGTTGATGACTACAGTTCTCGAGAACTGTAGTCATCAACCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-589s21c1
Sequence:CCGGGTGAACCCGAAGCAACAAGAACTCGAGTTCTTGTTGCTTCGGGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-367s21c1
Sequence:CCGGCACATTCAGCTTGCACAGAGTCTCGAGACTCTGTGCAAGCTGAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024430.3-1517s21c1
Sequence:CCGGGCCTCAGTGGTGCAAGATTTACTCGAGTAAATCTTGCACCACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024430.3-241s21c1
Sequence:CCGGGAAGAGAGGTATGGCAAAGATCTCGAGATCTTTGCCATACCTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013831
PSTPIP2 MISSION shRNA Bacterial Glycerol Stock
proline-serine-threonine phosphatase interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-837s1c1
Sequence:CCGGGCACTGTGGTTGCATCTGAATCTCGAGATTCAGATGCAACCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013831.2-1197s1c1
Sequence:CCGGCCTTGTGGCATGACAGGAAATCTCGAGATTTCCTGTCATGCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-242s1c1
Sequence:CCGGCCGTAAGAACTGCAAGGAGTTCTCGAGAACTCCTTGCAGTTCTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-879s1c1
Sequence:CCGGGCAAATGACGAGATGTATGAACTCGAGTTCATACATCTCGTCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-816s1c1
Sequence:CCGGCGAATCAACTTCTTCCGGAATCTCGAGATTCCGGAAGAAGTTGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013831
PSTPIP2 MISSION shRNA shRNA Plasmid DNA
proline-serine-threonine phosphatase interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-837s1c1
Sequence:CCGGGCACTGTGGTTGCATCTGAATCTCGAGATTCAGATGCAACCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013831.2-1197s1c1
Sequence:CCGGCCTTGTGGCATGACAGGAAATCTCGAGATTTCCTGTCATGCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-242s1c1
Sequence:CCGGCCGTAAGAACTGCAAGGAGTTCTCGAGAACTCCTTGCAGTTCTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-879s1c1
Sequence:CCGGGCAAATGACGAGATGTATGAACTCGAGTTCATACATCTCGTCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-816s1c1
Sequence:CCGGCGAATCAACTTCTTCCGGAATCTCGAGATTCCGGAAGAAGTTGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013831
PSTPIP2 MISSION shRNA Lentiviral Transduction Particles
proline-serine-threonine phosphatase interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-837s1c1
Sequence:CCGGGCACTGTGGTTGCATCTGAATCTCGAGATTCAGATGCAACCACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013831.2-1197s1c1
Sequence:CCGGCCTTGTGGCATGACAGGAAATCTCGAGATTTCCTGTCATGCCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-242s1c1
Sequence:CCGGCCGTAAGAACTGCAAGGAGTTCTCGAGAACTCCTTGCAGTTCTTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-879s1c1
Sequence:CCGGGCAAATGACGAGATGTATGAACTCGAGTTCATACATCTCGTCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013831.2-816s1c1
Sequence:CCGGCGAATCAACTTCTTCCGGAATCTCGAGATTCCGGAAGAAGTTGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)