EMAIL THIS PAGE TO A FRIEND

PTAR1

protein prenyltransferase alpha subunit repeat containing 1

100 Gene Product Result for
UniProtKB ID: Q7Z6K3, Q5T7V5, Q5T7V6
Gene ID:
Mouse(72351) protein prenyltransferase alpha subunit repeat containing 1
Rat(286972) protein prenyltransferase alpha subunit repeat containing 1
cow(784830) protein prenyltransferase alpha subunit repeat containing 1
sheep(101105722) protein prenyltransferase alpha subunit repeat containing 1
naked mole-rat(101721055) protein prenyltransferase alpha subunit repeat containing 1
Domestic Rabbit(100341064) protein prenyltransferase alpha subunit repeat containing 1
domestic guinea pig(100730368) protein prenyltransferase alpha subunit repeat containing 1
Zebrafish(561820) protein prenyltransferase alpha subunit repeat containing 1
domestic cat(101085670) protein prenyltransferase alpha subunit repeat containing 1
dog(484173) protein prenyltransferase alpha subunit repeat containing 1
chicken(431607) protein prenyltransferase alpha subunit repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026731 MISSION® esiRNA esiRNA human PTAR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099666 Rosetta Predictions human pricing
XM_372117 Rosetta Predictions human pricing
XM_931440 Rosetta Predictions human pricing
XM_931450 Rosetta Predictions human pricing
NM_001105760 Rosetta Predictions rat pricing
XM_001477013 Rosetta Predictions mouse pricing
XM_129160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320936 predicted 266
2 SASI_Hs02_00320937 predicted 405
3 SASI_Hs02_00320938 predicted 1317
4 SASI_Hs02_00320939 predicted 1218
5 SASI_Hs02_00320940 predicted 1061
6 SASI_Hs02_00320941 predicted 1034
7 SASI_Hs02_00320942 predicted 300
8 SASI_Hs02_00320943 predicted 1299
9 SASI_Hs02_00320944 predicted 725
10 SASI_Hs02_00320945 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274349 predicted 255
2 SASI_Hs01_00274350 predicted 1198
3 SASI_Hs01_00274351 predicted 392
4 SASI_Hs01_00274352 predicted 1310
5 SASI_Hs01_00274353 predicted 1211
6 SASI_Hs01_00274354 predicted 1056
7 SASI_Hs01_00274355 predicted 1030
8 SASI_Hs01_00274356 predicted 1185
9 SASI_Hs01_00274357 predicted 1296
10 SASI_Hs01_00274358 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251534 predicted 262
2 SASI_Hs01_00251535 predicted 463
3 SASI_Hs01_00251536 predicted 300
4 SASI_Hs01_00251537 predicted 329
5 SASI_Hs01_00251538 predicted 301
6 SASI_Hs01_00251539 predicted 259
7 SASI_Hs01_00251540 predicted 328
8 SASI_Hs01_00251541 predicted 270
9 SASI_Hs01_00251542 predicted 278
10 SASI_Hs01_00251543 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282958 predicted 257
2 SASI_Hs01_00282959 predicted 1283
3 SASI_Hs01_00282960 predicted 395
4 SASI_Hs01_00282961 predicted 1388
5 SASI_Hs01_00282962 predicted 1103
6 SASI_Hs01_00282963 predicted 292
7 SASI_Hs01_00282964 predicted 1372
8 SASI_Hs01_00282965 predicted 657
9 SASI_Hs01_00282966 predicted 1272
10 SASI_Hs01_00282967 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212256 predicted 267
2 SASI_Rn02_00212257 predicted 1066
3 SASI_Rn02_00212258 predicted 1255
4 SASI_Rn02_00212259 predicted 1194
5 SASI_Rn02_00212260 predicted 236
6 SASI_Rn02_00212261 predicted 1213
7 SASI_Rn02_00212262 predicted 577
8 SASI_Rn02_00212263 predicted 1117
9 SASI_Rn02_00212264 predicted 394
10 SASI_Rn02_00212265 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00392852 predicted 833
2 SASI_Mm02_00392853 predicted 613
3 SASI_Mm02_00392854 predicted 912
4 SASI_Mm02_00392855 predicted 1030
5 SASI_Mm02_00392856 predicted 345
6 SASI_Mm02_00392857 predicted 1008
7 SASI_Mm02_00392858 predicted 532
8 SASI_Mm02_00392859 predicted 1149
9 SASI_Mm02_00392860 predicted 827
10 SASI_Mm02_00392861 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253988 predicted 922
2 SASI_Mm01_00253989 predicted 705
3 SASI_Mm01_00253990 predicted 992
4 SASI_Mm01_00253991 predicted 1121
5 SASI_Mm01_00253993 predicted 432
6 SASI_Mm01_00253994 predicted 1094
7 SASI_Mm01_00253995 predicted 617
8 SASI_Mm02_00424302 predicted 1242
9 SASI_Mm01_00253996 predicted 908
10 SASI_Mm02_00424303 predicted 391
11 SASI_Mm01_00253987 predicted 285
12 SASI_Mm01_00253992 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372117
VALIDATED
PTAR1 MISSION shRNA Bacterial Glycerol Stock
protein prenyltransferase alpha subunit repeat containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-706s1c1
Sequence:CCGGGCCAAGCTAGATGTCAAGATTCTCGAGAATCTTGACATCTAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-603s1c1
Sequence:CCGGGCGACTCATACAAGAAGAGATCTCGAGATCTCTTCTTGTATGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-165s1c1
Sequence:CCGGCATAGATGAAATTGGCCTGATCTCGAGATCAGGCCAATTTCATCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-1255s1c1
Sequence:CCGGGCATACAGGAAATGGCTGGTTCTCGAGAACCAGCCATTTCCTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-465s1c1
Sequence:CCGGCGCCTTAACCAAGTTTCCAAACTCGAGTTTGGAAACTTGGTTAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372117
VALIDATED
PTAR1 MISSION shRNA shRNA Plasmid DNA
protein prenyltransferase alpha subunit repeat containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-706s1c1
Sequence:CCGGGCCAAGCTAGATGTCAAGATTCTCGAGAATCTTGACATCTAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-603s1c1
Sequence:CCGGGCGACTCATACAAGAAGAGATCTCGAGATCTCTTCTTGTATGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-165s1c1
Sequence:CCGGCATAGATGAAATTGGCCTGATCTCGAGATCAGGCCAATTTCATCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-1255s1c1
Sequence:CCGGGCATACAGGAAATGGCTGGTTCTCGAGAACCAGCCATTTCCTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-465s1c1
Sequence:CCGGCGCCTTAACCAAGTTTCCAAACTCGAGTTTGGAAACTTGGTTAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372117
VALIDATED
PTAR1 MISSION shRNA Lentiviral Transduction Particles
protein prenyltransferase alpha subunit repeat containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-706s1c1
Sequence:CCGGGCCAAGCTAGATGTCAAGATTCTCGAGAATCTTGACATCTAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_372117.1-603s1c1
Sequence:CCGGGCGACTCATACAAGAAGAGATCTCGAGATCTCTTCTTGTATGAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-165s1c1
Sequence:CCGGCATAGATGAAATTGGCCTGATCTCGAGATCAGGCCAATTTCATCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-1255s1c1
Sequence:CCGGGCATACAGGAAATGGCTGGTTCTCGAGAACCAGCCATTTCCTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372117.1-465s1c1
Sequence:CCGGCGCCTTAACCAAGTTTCCAAACTCGAGTTTGGAAACTTGGTTAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099666
PTAR1 MISSION shRNA Bacterial Glycerol Stock
protein prenyltransferase alpha subunit repeat containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-130s21c1
Sequence:CCGGATGTCCTGAAGCTAGGTATAACTCGAGTTATACCTAGCTTCAGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-362s21c1
Sequence:CCGGTCTGGCACTTTAAATCCAATTCTCGAGAATTGGATTTAAAGTGCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-960s21c1
Sequence:CCGGGGTGTCATAGGCGGCATATTTCTCGAGAAATATGCCGCCTATGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1109s21c1
Sequence:CCGGGACTCCCTAGGCCTAGAAATGCTCGAGCATTTCTAGGCCTAGGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-456s21c1
Sequence:CCGGGGGTGCTACAACAGCTAATTCCTCGAGGAATTAGCTGTTGTAGCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099666.1-1560s21c1
Sequence:CCGGCCAATTGCTGCATAGGCAAATCTCGAGATTTGCCTATGCAGCAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-674s21c1
Sequence:CCGGGATGAACTATCTTCTACTAAACTCGAGTTTAGTAGAAGATAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1050s21c1
Sequence:CCGGACTCTAGCAAGCAAGGCTATTCTCGAGAATAGCCTTGCTTGCTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-590s21c1
Sequence:CCGGAGATACCCAAGCAACTATAATCTCGAGATTATAGTTGCTTGGGTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099666
PTAR1 MISSION shRNA shRNA Plasmid DNA
protein prenyltransferase alpha subunit repeat containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-130s21c1
Sequence:CCGGATGTCCTGAAGCTAGGTATAACTCGAGTTATACCTAGCTTCAGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-362s21c1
Sequence:CCGGTCTGGCACTTTAAATCCAATTCTCGAGAATTGGATTTAAAGTGCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-960s21c1
Sequence:CCGGGGTGTCATAGGCGGCATATTTCTCGAGAAATATGCCGCCTATGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1109s21c1
Sequence:CCGGGACTCCCTAGGCCTAGAAATGCTCGAGCATTTCTAGGCCTAGGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-456s21c1
Sequence:CCGGGGGTGCTACAACAGCTAATTCCTCGAGGAATTAGCTGTTGTAGCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099666.1-1560s21c1
Sequence:CCGGCCAATTGCTGCATAGGCAAATCTCGAGATTTGCCTATGCAGCAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-674s21c1
Sequence:CCGGGATGAACTATCTTCTACTAAACTCGAGTTTAGTAGAAGATAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1050s21c1
Sequence:CCGGACTCTAGCAAGCAAGGCTATTCTCGAGAATAGCCTTGCTTGCTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-590s21c1
Sequence:CCGGAGATACCCAAGCAACTATAATCTCGAGATTATAGTTGCTTGGGTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099666
PTAR1 MISSION shRNA Lentiviral Transduction Particles
protein prenyltransferase alpha subunit repeat containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-130s21c1
Sequence:CCGGATGTCCTGAAGCTAGGTATAACTCGAGTTATACCTAGCTTCAGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-362s21c1
Sequence:CCGGTCTGGCACTTTAAATCCAATTCTCGAGAATTGGATTTAAAGTGCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-960s21c1
Sequence:CCGGGGTGTCATAGGCGGCATATTTCTCGAGAAATATGCCGCCTATGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1109s21c1
Sequence:CCGGGACTCCCTAGGCCTAGAAATGCTCGAGCATTTCTAGGCCTAGGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-456s21c1
Sequence:CCGGGGGTGCTACAACAGCTAATTCCTCGAGGAATTAGCTGTTGTAGCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099666.1-1560s21c1
Sequence:CCGGCCAATTGCTGCATAGGCAAATCTCGAGATTTGCCTATGCAGCAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-674s21c1
Sequence:CCGGGATGAACTATCTTCTACTAAACTCGAGTTTAGTAGAAGATAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-1050s21c1
Sequence:CCGGACTCTAGCAAGCAAGGCTATTCTCGAGAATAGCCTTGCTTGCTAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099666.1-590s21c1
Sequence:CCGGAGATACCCAAGCAACTATAATCTCGAGATTATAGTTGCTTGGGTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028208
VALIDATED
PTAR1 MISSION shRNA Bacterial Glycerol Stock
protein prenyltransferase alpha subunit repeat containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1518s21c1
Sequence:CCGGTATAGTTCCTTCCTACTAAATCTCGAGATTTAGTAGGAAGGAACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-1004s21c1
Sequence:CCGGTCTACCTTCAGCATCACTTAACTCGAGTTAAGTGATGCTGAAGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-712s21c1
Sequence:CCGGGATGAACTGTCTTCTACTAAACTCGAGTTTAGTAGAAGACAGTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-571s21c1
Sequence:CCGGGAGAGGACACAGCGGATAATACTCGAGTATTATCCGCTGTGTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-402s21c1
Sequence:CCGGTGGCACTTTAAGTCCAATTAACTCGAGTTAATTGGACTTAAAGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1239s21c1
Sequence:CCGGCAGGTTTATTGATCAAGTATTCTCGAGAATACTTGATCAATAAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1809s21c1
Sequence:CCGGCAAGCGTGTTCTCCCGTTATCCTCGAGGATAACGGGAGAACACGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-235s21c1
Sequence:CCGGTGGTGTGTCAAGTTCTTATTACTCGAGTAATAAGAACTTGACACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028208
VALIDATED
PTAR1 MISSION shRNA shRNA Plasmid DNA
protein prenyltransferase alpha subunit repeat containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1518s21c1
Sequence:CCGGTATAGTTCCTTCCTACTAAATCTCGAGATTTAGTAGGAAGGAACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-1004s21c1
Sequence:CCGGTCTACCTTCAGCATCACTTAACTCGAGTTAAGTGATGCTGAAGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-712s21c1
Sequence:CCGGGATGAACTGTCTTCTACTAAACTCGAGTTTAGTAGAAGACAGTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-571s21c1
Sequence:CCGGGAGAGGACACAGCGGATAATACTCGAGTATTATCCGCTGTGTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-402s21c1
Sequence:CCGGTGGCACTTTAAGTCCAATTAACTCGAGTTAATTGGACTTAAAGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1239s21c1
Sequence:CCGGCAGGTTTATTGATCAAGTATTCTCGAGAATACTTGATCAATAAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1809s21c1
Sequence:CCGGCAAGCGTGTTCTCCCGTTATCCTCGAGGATAACGGGAGAACACGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-235s21c1
Sequence:CCGGTGGTGTGTCAAGTTCTTATTACTCGAGTAATAAGAACTTGACACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028208
VALIDATED
PTAR1 MISSION shRNA Lentiviral Transduction Particles
protein prenyltransferase alpha subunit repeat containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1518s21c1
Sequence:CCGGTATAGTTCCTTCCTACTAAATCTCGAGATTTAGTAGGAAGGAACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-1004s21c1
Sequence:CCGGTCTACCTTCAGCATCACTTAACTCGAGTTAAGTGATGCTGAAGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-712s21c1
Sequence:CCGGGATGAACTGTCTTCTACTAAACTCGAGTTTAGTAGAAGACAGTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-571s21c1
Sequence:CCGGGAGAGGACACAGCGGATAATACTCGAGTATTATCCGCTGTGTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028208.1-402s21c1
Sequence:CCGGTGGCACTTTAAGTCCAATTAACTCGAGTTAATTGGACTTAAAGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1239s21c1
Sequence:CCGGCAGGTTTATTGATCAAGTATTCTCGAGAATACTTGATCAATAAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-1809s21c1
Sequence:CCGGCAAGCGTGTTCTCCCGTTATCCTCGAGGATAACGGGAGAACACGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028208.1-235s21c1
Sequence:CCGGTGGTGTGTCAAGTTCTTATTACTCGAGTAATAAGAACTTGACACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)