EMAIL THIS PAGE TO A FRIEND

PTBP1

polypyrimidine tract binding protein 1

145 Gene Product Result for
Synonyms: HNRNP-I HNRNPI HNRPI PTB PTB-1 PTB-T PTB2 PTB3 PTB4 pPTB
UniProtKB ID: P26599, Q9BUQ0
Gene ID:
Human(5725) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(19205) polypyrimidine tract binding protein 1
Rat(29497) polypyrimidine tract binding protein 1
chicken(420098) polypyrimidine tract binding protein 1
dog(485097) polypyrimidine tract binding protein 1
Horse(100061673) polypyrimidine tract binding protein 1
domestic cat(101092744) polypyrimidine tract binding protein 1
cow(282018) polypyrimidine tract binding protein 1
sheep(101115119) polypyrimidine tract binding protein 1
domestic guinea pig(100721462) polypyrimidine tract binding protein 1
naked mole-rat(101715554) polypyrimidine tract binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301714 Anti-PTBP1 affinity isolated antibody human
immunohistochemistry, western blot pricing
AV40421 Anti-PTBP1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human, bovine, rat
western blot pricing
SAB2101904 Anti-PTBP1 antibody produced in rabbit affinity isolated antibody mouse, human, guinea pig, rat, rabbit, dog, horse, bovine
western blot pricing
SAB1411139 Anti-PTBP1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2500834 Anti-PTBP1/PTB antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
WH0005725M1 Monoclonal Anti-PTBP1 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088121 MISSION® esiRNA esiRNA human PTBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002819 Rosetta Predictions human pricing
NM_031990 Rosetta Predictions human pricing
NM_031991 Rosetta Predictions human pricing
NM_175847 Rosetta Predictions human pricing
NM_022516 Rosetta Predictions rat pricing
NM_001077363 Rosetta Predictions mouse pricing
NM_008956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216643 predicted 1440
2 SASI_Hs02_00334513 predicted 1488
3 SASI_Hs01_00216644 predicted 2258
4 SASI_Hs01_00216645 predicted 2251
5 SASI_Hs01_00216646 predicted 1600
6 SASI_Hs02_00334514 predicted 1789
7 SASI_Hs01_00216647 predicted 153
8 SASI_Hs01_00216648 predicted 1836
9 SASI_Hs01_00216650 predicted 1051
10 SASI_Hs01_00216651 predicted 871
11 SASI_Hs01_00216649 predicted 339
12 SASI_Hs01_00216652 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060054 predicted 1412
2 SASI_Hs02_00359175 predicted 1467
3 SASI_Hs01_00060055 predicted 2234
4 SASI_Hs01_00060056 predicted 2228
5 SASI_Hs01_00060057 predicted 1573
6 SASI_Hs02_00359176 predicted 1773
7 SASI_Hs01_00060058 predicted 154
8 SASI_Hs01_00060059 predicted 1814
9 SASI_Hs01_00060061 predicted 1036
10 SASI_Hs01_00060062 predicted 867
11 SASI_Hs01_00060060 predicted 347
12 SASI_Hs01_00060063 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202697 predicted 1354
2 SASI_Hs02_00359177 predicted 1408
3 SASI_Hs01_00202698 predicted 2174
4 SASI_Hs01_00202699 predicted 2167
5 SASI_Hs01_00202700 predicted 1522
6 SASI_Hs02_00359178 predicted 1715
7 SASI_Hs01_00202701 predicted 151
8 SASI_Hs01_00202703 predicted 874
9 SASI_Hs01_00202704 predicted 92
10 SASI_Hs01_00202705 predicted 1748
11 SASI_Hs01_00202702 predicted 345
12 SASI_Hs01_00202706 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135183 predicted 359
2 SASI_Hs01_00135188 predicted 410
3 SASI_Hs01_00135184 predicted 1172
4 SASI_Hs01_00135185 predicted 1170
5 SASI_Hs01_00135186 predicted 520
6 SASI_Hs01_00135187 predicted 712
7 SASI_Hs01_00135189 predicted 757
8 SASI_Hs01_00135190 predicted 94
9 SASI_Hs01_00135191 predicted 755
10 SASI_Hs01_00135192 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058448 predicted 1756
2 SASI_Rn01_00058449 predicted 1999
3 SASI_Rn01_00058450 predicted 1625
4 SASI_Rn01_00058451 predicted 2064
5 SASI_Rn01_00058452 predicted 1297
6 SASI_Rn01_00058453 predicted 2086
7 SASI_Rn01_00058454 predicted 1450
8 SASI_Rn01_00058455 predicted 1932
9 SASI_Rn01_00058456 predicted 2078
10 SASI_Rn01_00058457 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292552 predicted 360
2 SASI_Mm02_00292553 predicted 1833
3 SASI_Mm02_00292554 predicted 339
4 SASI_Mm02_00292555 predicted 2019
5 SASI_Mm02_00292556 predicted 1450
6 SASI_Mm02_00292557 predicted 1926
7 SASI_Mm02_00292558 predicted 1511
8 SASI_Mm02_00292559 predicted 1872
9 SASI_Mm02_00292560 predicted 1391
10 SASI_Mm02_00292561 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188169 predicted 353
2 SASI_Mm02_00315021 predicted 1751
3 SASI_Mm02_00315022 predicted 342
4 SASI_Mm01_00188170 predicted 1940
5 SASI_Mm01_00188173 predicted 1369
6 SASI_Mm02_00315023 predicted 1852
7 SASI_Mm02_00315024 predicted 1440
8 SASI_Mm02_00315025 predicted 1796
9 SASI_Mm01_00188178 predicted 1309
10 SASI_Mm02_00315026 predicted 1524
11 SASI_Mm01_00188171 predicted 627
12 SASI_Mm01_00188172 predicted 489
13 SASI_Mm01_00188174 predicted 2108
14 SASI_Mm01_00188175 predicted 2072
15 SASI_Mm01_00188176 predicted 1893
16 SASI_Mm01_00188177 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008956
VALIDATED
PTBP1 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-430s21c1
Sequence:CCGGCACTATGGTTAACTACTATACCTCGAGGTATAGTAGTTAACCATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-893s21c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1156s21c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1764s21c1
Sequence:CCGGGACCTTACAGACCAGAGATTTCTCGAGAAATCTCTGGTCTGTAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1081s1c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1848s1c1
Sequence:CCGGCCGCTTTCTGTGCCTTACAAACTCGAGTTTGTAAGGCACAGAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1123s1c1
Sequence:CCGGGCGGGTGAAGATCCTGTTCAACTCGAGTTGAACAGGATCTTCACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008956.1-814s1c1
Sequence:CCGGCAGTCTCAATGTCAAGTACAACTCGAGTTGTACTTGACATTGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-818s1c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008956
VALIDATED
PTBP1 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-430s21c1
Sequence:CCGGCACTATGGTTAACTACTATACCTCGAGGTATAGTAGTTAACCATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-893s21c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1156s21c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1764s21c1
Sequence:CCGGGACCTTACAGACCAGAGATTTCTCGAGAAATCTCTGGTCTGTAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1081s1c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1848s1c1
Sequence:CCGGCCGCTTTCTGTGCCTTACAAACTCGAGTTTGTAAGGCACAGAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1123s1c1
Sequence:CCGGGCGGGTGAAGATCCTGTTCAACTCGAGTTGAACAGGATCTTCACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008956.1-814s1c1
Sequence:CCGGCAGTCTCAATGTCAAGTACAACTCGAGTTGTACTTGACATTGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-818s1c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008956
VALIDATED
PTBP1 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-430s21c1
Sequence:CCGGCACTATGGTTAACTACTATACCTCGAGGTATAGTAGTTAACCATAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-893s21c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1156s21c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008956.2-1764s21c1
Sequence:CCGGGACCTTACAGACCAGAGATTTCTCGAGAAATCTCTGGTCTGTAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1081s1c1
Sequence:CCGGCCAAAGCCTCTTTATTCTCTTCTCGAGAAGAGAATAAAGAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1848s1c1
Sequence:CCGGCCGCTTTCTGTGCCTTACAAACTCGAGTTTGTAAGGCACAGAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-1123s1c1
Sequence:CCGGGCGGGTGAAGATCCTGTTCAACTCGAGTTGAACAGGATCTTCACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008956.1-814s1c1
Sequence:CCGGCAGTCTCAATGTCAAGTACAACTCGAGTTGTACTTGACATTGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008956.1-818s1c1
Sequence:CCGGCTCAATGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002819
VALIDATED
PTBP1 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-193s21c1
Sequence:CCGGGCTTCTGCAGCAAACGGAAATCTCGAGATTTCCGTTTGCTGCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-3120s21c1
Sequence:CCGGACGCGGAGAGAACCGATTAAACTCGAGTTTAATCGGTTCTCTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-1262s21c1
Sequence:CCGGGCGTGAAGATCCTGTTCAATACTCGAGTATTGAACAGGATCTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002819.x-1602s1c1
Sequence:CCGGCGTCGTCAAAGGATTCAAGTTCTCGAGAACTTGAATCCTTTGACGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-456s1c1
Sequence:CCGGCCAGCCCATCTACATCCAGTTCTCGAGAACTGGATGTAGATGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002819.x-201s1c1
Sequence:CCGGAGCAAACGGAAATGACAGCAACTCGAGTTGCTGTCATTTCCGTTTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-874s1c1
Sequence:CCGGCTCAACGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACGTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002819.3-975s21c1
Sequence:CCGGCTTCGGTGCACCTGGTATAATCTCGAGATTATACCAGGTGCACCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-156s21c1
Sequence:CCGGTGTCACTAACGGACCGTTTATCTCGAGATAAACGGTCCGTTAGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002819
VALIDATED
PTBP1 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-193s21c1
Sequence:CCGGGCTTCTGCAGCAAACGGAAATCTCGAGATTTCCGTTTGCTGCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-3120s21c1
Sequence:CCGGACGCGGAGAGAACCGATTAAACTCGAGTTTAATCGGTTCTCTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-1262s21c1
Sequence:CCGGGCGTGAAGATCCTGTTCAATACTCGAGTATTGAACAGGATCTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002819.x-1602s1c1
Sequence:CCGGCGTCGTCAAAGGATTCAAGTTCTCGAGAACTTGAATCCTTTGACGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-456s1c1
Sequence:CCGGCCAGCCCATCTACATCCAGTTCTCGAGAACTGGATGTAGATGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002819.x-201s1c1
Sequence:CCGGAGCAAACGGAAATGACAGCAACTCGAGTTGCTGTCATTTCCGTTTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-874s1c1
Sequence:CCGGCTCAACGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACGTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002819.3-975s21c1
Sequence:CCGGCTTCGGTGCACCTGGTATAATCTCGAGATTATACCAGGTGCACCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-156s21c1
Sequence:CCGGTGTCACTAACGGACCGTTTATCTCGAGATAAACGGTCCGTTAGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002819
VALIDATED
PTBP1 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-193s21c1
Sequence:CCGGGCTTCTGCAGCAAACGGAAATCTCGAGATTTCCGTTTGCTGCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-3120s21c1
Sequence:CCGGACGCGGAGAGAACCGATTAAACTCGAGTTTAATCGGTTCTCTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-1262s21c1
Sequence:CCGGGCGTGAAGATCCTGTTCAATACTCGAGTATTGAACAGGATCTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002819.x-1602s1c1
Sequence:CCGGCGTCGTCAAAGGATTCAAGTTCTCGAGAACTTGAATCCTTTGACGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-456s1c1
Sequence:CCGGCCAGCCCATCTACATCCAGTTCTCGAGAACTGGATGTAGATGGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002819.x-201s1c1
Sequence:CCGGAGCAAACGGAAATGACAGCAACTCGAGTTGCTGTCATTTCCGTTTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002819.x-874s1c1
Sequence:CCGGCTCAACGTCAAGTACAACAATCTCGAGATTGTTGTACTTGACGTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002819.3-975s21c1
Sequence:CCGGCTTCGGTGCACCTGGTATAATCTCGAGATTATACCAGGTGCACCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002819.3-156s21c1
Sequence:CCGGTGTCACTAACGGACCGTTTATCTCGAGATAAACGGTCCGTTAGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)