EMAIL THIS PAGE TO A FRIEND

PTBP2

polypyrimidine tract binding protein 2

177 Gene Product Result for
Synonyms: PTB PTBLP brPTB nPTB nPTB5 nPTB6 nPTB7 nPTB8
Gene ID:
Human(58155) Summary: The protein encoded by this gene binds to the intronic cluster of RNA regulatory elements, downstream control sequence (DCS). It is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein but it is expressed primarily in the brain. [provided by RefSeq, Jul 2008]
Mouse(56195) polypyrimidine tract binding protein 2
Rat(310820) polypyrimidine tract binding protein 2
chicken(424479) polypyrimidine tract binding protein 2
dog(490149) polypyrimidine tract binding protein 2
Horse(100057336) polypyrimidine tract binding protein 2
domestic cat(101083867) polypyrimidine tract binding protein 2
naked mole-rat(101726224) polypyrimidine tract binding protein 2
Domestic Rabbit(100349676) polypyrimidine tract binding protein 2
domestic guinea pig(100727628) polypyrimidine tract binding protein 2
cow(537341) polypyrimidine tract binding protein 2
sheep(101109051) polypyrimidine tract binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021190 Rosetta Predictions human pricing
NM_001005555 Rosetta Predictions rat pricing
NM_019550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201967 predicted 1462
2 SASI_Hs01_00201968 predicted 1268
3 SASI_Hs01_00201970 predicted 649
4 SASI_Hs01_00201971 predicted 1306
5 SASI_Hs01_00201972 predicted 1274
6 SASI_Hs02_00354766 predicted 540
7 SASI_Hs01_00201973 predicted 270
8 SASI_Hs01_00201974 predicted 456
9 SASI_Hs01_00201975 predicted 440
10 SASI_Hs01_00201976 predicted 312
11 SASI_Hs01_00201969 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198417 predicted 1096
2 SASI_Rn01_00041367 predicted 887
3 SASI_Rn01_00041368 predicted 1589
4 SASI_Rn01_00041369 predicted 687
5 SASI_Rn01_00041370 predicted 399
6 SASI_Rn01_00041371 predicted 1321
7 SASI_Rn01_00041372 predicted 300
8 SASI_Rn01_00041373 predicted 647
9 SASI_Rn01_00041374 predicted 1154
10 SASI_Rn01_00041375 predicted 495
11 SASI_Rn01_00041376 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031283 predicted 482
2 SASI_Mm01_00031284 predicted 1558
3 SASI_Mm01_00031285 predicted 653
4 SASI_Mm01_00031286 predicted 364
5 SASI_Mm01_00031287 predicted 1291
6 SASI_Mm02_00324592 predicted 305
7 SASI_Mm01_00031288 predicted 1309
8 SASI_Mm01_00031290 predicted 458
9 SASI_Mm01_00031291 predicted 262
10 SASI_Mm01_00031292 predicted 234
11 SASI_Mm01_00031289 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021190
VALIDATED
PTBP2 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-762s1c1
Sequence:CCGGCCCTAGATGGTCAGAATATTTCTCGAGAAATATTCTGACCATCTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1263s21c1
Sequence:CCGGCCTGTTGGTTAGCAATTTAAACTCGAGTTTAAATTGCTAACCAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-410s1c1
Sequence:CCGGCATCTTCGTAACCAACCAATACTCGAGTATTGGTTGGTTACGAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021190.x-219s1c1
Sequence:CCGGCTCCTTCTCGTGTACTTCATACTCGAGTATGAAGTACACGAGAAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-1415s1c1
Sequence:CCGGGCCACCCTTCACCTATCTAATCTCGAGATTAGATAGGTGAAGGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021190.x-1782s1c1
Sequence:CCGGCTGTTATCATTCCTTGGTTATCTCGAGATAACCAAGGAATGATAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-915s21c1
Sequence:CCGGCCAGTATGGTGATCCAGTAAACTCGAGTTTACTGGATCACCATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021190.2-1878s21c1
Sequence:CCGGGTTCAATGTCATCACCTATTTCTCGAGAAATAGGTGATGACATTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1365s21c1
Sequence:CCGGTAAGAAAGACAGCGCTCTAATCTCGAGATTAGAGCGCTGTCTTTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1311s21c1
Sequence:CCGGGTTTACCCTCTTCGGTGTTTACTCGAGTAAACACCGAAGAGGGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-562s21c1
Sequence:CCGGGCAGCTATTACTATGGTTAATCTCGAGATTAACCATAGTAATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-771s21c1
Sequence:CCGGAGCCCAGAGTCCAGTACTTAGCTCGAGCTAAGTACTGGACTCTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021190
VALIDATED
PTBP2 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-762s1c1
Sequence:CCGGCCCTAGATGGTCAGAATATTTCTCGAGAAATATTCTGACCATCTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1263s21c1
Sequence:CCGGCCTGTTGGTTAGCAATTTAAACTCGAGTTTAAATTGCTAACCAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-410s1c1
Sequence:CCGGCATCTTCGTAACCAACCAATACTCGAGTATTGGTTGGTTACGAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021190.x-219s1c1
Sequence:CCGGCTCCTTCTCGTGTACTTCATACTCGAGTATGAAGTACACGAGAAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-1415s1c1
Sequence:CCGGGCCACCCTTCACCTATCTAATCTCGAGATTAGATAGGTGAAGGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021190.x-1782s1c1
Sequence:CCGGCTGTTATCATTCCTTGGTTATCTCGAGATAACCAAGGAATGATAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-915s21c1
Sequence:CCGGCCAGTATGGTGATCCAGTAAACTCGAGTTTACTGGATCACCATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021190.2-1878s21c1
Sequence:CCGGGTTCAATGTCATCACCTATTTCTCGAGAAATAGGTGATGACATTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1365s21c1
Sequence:CCGGTAAGAAAGACAGCGCTCTAATCTCGAGATTAGAGCGCTGTCTTTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1311s21c1
Sequence:CCGGGTTTACCCTCTTCGGTGTTTACTCGAGTAAACACCGAAGAGGGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-562s21c1
Sequence:CCGGGCAGCTATTACTATGGTTAATCTCGAGATTAACCATAGTAATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-771s21c1
Sequence:CCGGAGCCCAGAGTCCAGTACTTAGCTCGAGCTAAGTACTGGACTCTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021190
VALIDATED
PTBP2 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-762s1c1
Sequence:CCGGCCCTAGATGGTCAGAATATTTCTCGAGAAATATTCTGACCATCTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1263s21c1
Sequence:CCGGCCTGTTGGTTAGCAATTTAAACTCGAGTTTAAATTGCTAACCAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-410s1c1
Sequence:CCGGCATCTTCGTAACCAACCAATACTCGAGTATTGGTTGGTTACGAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021190.x-219s1c1
Sequence:CCGGCTCCTTCTCGTGTACTTCATACTCGAGTATGAAGTACACGAGAAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021190.x-1415s1c1
Sequence:CCGGGCCACCCTTCACCTATCTAATCTCGAGATTAGATAGGTGAAGGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021190.x-1782s1c1
Sequence:CCGGCTGTTATCATTCCTTGGTTATCTCGAGATAACCAAGGAATGATAACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-915s21c1
Sequence:CCGGCCAGTATGGTGATCCAGTAAACTCGAGTTTACTGGATCACCATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021190.2-1878s21c1
Sequence:CCGGGTTCAATGTCATCACCTATTTCTCGAGAAATAGGTGATGACATTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1365s21c1
Sequence:CCGGTAAGAAAGACAGCGCTCTAATCTCGAGATTAGAGCGCTGTCTTTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-1311s21c1
Sequence:CCGGGTTTACCCTCTTCGGTGTTTACTCGAGTAAACACCGAAGAGGGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-562s21c1
Sequence:CCGGGCAGCTATTACTATGGTTAATCTCGAGATTAACCATAGTAATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021190.2-771s21c1
Sequence:CCGGAGCCCAGAGTCCAGTACTTAGCTCGAGCTAAGTACTGGACTCTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019550
VALIDATED
PTBP2 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-848s21c1
Sequence:CCGGCCAGTATGGTGATCCGGTAAACTCGAGTTTACCGGATCACCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019550.1-1745s1c1
Sequence:CCGGGCTGTTATCATTCCTTGGTTACTCGAGTAACCAAGGAATGATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-789s1c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-899s1c1
Sequence:CCGGCCTGCGTTAGACCCAGCCATTCTCGAGAATGGCTGGGTCTAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-418s1c1
Sequence:CCGGCCAACCAATTTACATCCAGTACTCGAGTACTGGATGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-1216s1c1
Sequence:CCGGGCTCGCCATGAATCATCTTAACTCGAGTTAAGATGATTCATGGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019550.1-789s21c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-272s21c1
Sequence:CCGGTATGAGTGGCATGGTAGTTACCTCGAGGTAACTACCATGCCACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019550
VALIDATED
PTBP2 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-848s21c1
Sequence:CCGGCCAGTATGGTGATCCGGTAAACTCGAGTTTACCGGATCACCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019550.1-1745s1c1
Sequence:CCGGGCTGTTATCATTCCTTGGTTACTCGAGTAACCAAGGAATGATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-789s1c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-899s1c1
Sequence:CCGGCCTGCGTTAGACCCAGCCATTCTCGAGAATGGCTGGGTCTAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-418s1c1
Sequence:CCGGCCAACCAATTTACATCCAGTACTCGAGTACTGGATGTAAATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-1216s1c1
Sequence:CCGGGCTCGCCATGAATCATCTTAACTCGAGTTAAGATGATTCATGGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019550.1-789s21c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-272s21c1
Sequence:CCGGTATGAGTGGCATGGTAGTTACCTCGAGGTAACTACCATGCCACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019550
VALIDATED
PTBP2 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-848s21c1
Sequence:CCGGCCAGTATGGTGATCCGGTAAACTCGAGTTTACCGGATCACCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019550.1-1745s1c1
Sequence:CCGGGCTGTTATCATTCCTTGGTTACTCGAGTAACCAAGGAATGATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-789s1c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019550.1-899s1c1
Sequence:CCGGCCTGCGTTAGACCCAGCCATTCTCGAGAATGGCTGGGTCTAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-418s1c1
Sequence:CCGGCCAACCAATTTACATCCAGTACTCGAGTACTGGATGTAAATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019550.1-1216s1c1
Sequence:CCGGGCTCGCCATGAATCATCTTAACTCGAGTTAAGATGATTCATGGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019550.1-789s21c1
Sequence:CCGGGCTGTACCCTAAGGATTGATTCTCGAGAATCAATCCTTAGGGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019550.2-272s21c1
Sequence:CCGGTATGAGTGGCATGGTAGTTACCTCGAGGTAACTACCATGCCACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)