EMAIL THIS PAGE TO A FRIEND

PTCD2

pentatricopeptide repeat domain 2

99 Gene Product Result for
UniProtKB ID: Q8WV60, Q6IA65, Q9H9R0
Gene ID:
Mouse(68927) pentatricopeptide repeat domain 2
Rat(310025) pentatricopeptide repeat domain 2
cow(514705) pentatricopeptide repeat domain 2
sheep(101115989) pentatricopeptide repeat domain 2
domestic guinea pig(100735229) pentatricopeptide repeat domain 2
naked mole-rat(101722330) pentatricopeptide repeat domain 2
Zebrafish(550275) pentatricopeptide repeat domain 2
domestic cat(101095948) pentatricopeptide repeat domain 2
dog(610392) pentatricopeptide repeat domain 2
chicken(427217) pentatricopeptide repeat domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024754 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024754 Rosetta Predictions human pricing
NM_001107648 Rosetta Predictions rat pricing
NM_026873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133850 predicted 477
2 SASI_Hs02_00357250 predicted 290
3 SASI_Hs01_00133851 predicted 785
4 SASI_Hs01_00133852 predicted 1046
5 SASI_Hs01_00133853 predicted 679
6 SASI_Hs01_00133854 predicted 554
7 SASI_Hs01_00133855 predicted 742
8 SASI_Hs01_00133856 predicted 730
9 SASI_Hs02_00357251 predicted 1044
10 SASI_Hs01_00133857 predicted 640
11 SASI_Hs01_00133858 predicted 853
12 SASI_Hs01_00133859 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230905 predicted 874
2 SASI_Rn02_00230906 predicted 750
3 SASI_Rn02_00230907 predicted 785
4 SASI_Rn02_00230908 predicted 448
5 SASI_Rn02_00230909 predicted 899
6 SASI_Rn02_00230910 predicted 689
7 SASI_Rn02_00230911 predicted 811
8 SASI_Rn02_00230912 predicted 1210
9 SASI_Rn02_00230913 predicted 995
10 SASI_Rn02_00230914 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071881 predicted 1139
2 SASI_Mm01_00071882 predicted 1024
3 SASI_Mm01_00071883 predicted 671
4 SASI_Mm01_00071884 predicted 767
5 SASI_Mm01_00071885 predicted 976
6 SASI_Mm01_00071886 predicted 516
7 SASI_Mm01_00071887 predicted 655
8 SASI_Mm01_00071888 predicted 860
9 SASI_Mm01_00071889 predicted 786
10 SASI_Mm01_00071890 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026873
PTCD2 MISSION shRNA Bacterial Glycerol Stock
pentatricopeptide repeat domain 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026873.2-1426s21c1
Sequence:CCGGGTACCCACAGACGGGATTTCTCTCGAGAGAAATCCCGTCTGTGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-314s21c1
Sequence:CCGGAGCTGGCGAAAGCCGTCATTTCTCGAGAAATGACGGCTTTCGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-662s21c1
Sequence:CCGGTAAGAGAAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTTCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-163s1c1
Sequence:CCGGCAACATAAGAAGATAGCTATTCTCGAGAATAGCTATCTTCTTATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-822s1c1
Sequence:CCGGGATCCACATCCAGTCAAATATCTCGAGATATTTGACTGGATGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-627s1c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-1002s21c1
Sequence:CCGGGCTGCACGTGAACGGTCAAATCTCGAGATTTGACCGTTCACGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-627s21c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-787s1c1
Sequence:CCGGCCAGAAAGCATAGTGTGTATTCTCGAGAATACACACTATGCTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-325s1c1
Sequence:CCGGGCCGTCATTTATAGGTACCATCTCGAGATGGTACCTATAAATGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026873.1-1300s1c1
Sequence:CCGGCCAGAGAAATGGGAAGAGCTACTCGAGTAGCTCTTCCCATTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026873
PTCD2 MISSION shRNA shRNA Plasmid DNA
pentatricopeptide repeat domain 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026873.2-1426s21c1
Sequence:CCGGGTACCCACAGACGGGATTTCTCTCGAGAGAAATCCCGTCTGTGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-314s21c1
Sequence:CCGGAGCTGGCGAAAGCCGTCATTTCTCGAGAAATGACGGCTTTCGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-662s21c1
Sequence:CCGGTAAGAGAAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTTCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-163s1c1
Sequence:CCGGCAACATAAGAAGATAGCTATTCTCGAGAATAGCTATCTTCTTATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-822s1c1
Sequence:CCGGGATCCACATCCAGTCAAATATCTCGAGATATTTGACTGGATGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-627s1c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-1002s21c1
Sequence:CCGGGCTGCACGTGAACGGTCAAATCTCGAGATTTGACCGTTCACGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-627s21c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-787s1c1
Sequence:CCGGCCAGAAAGCATAGTGTGTATTCTCGAGAATACACACTATGCTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-325s1c1
Sequence:CCGGGCCGTCATTTATAGGTACCATCTCGAGATGGTACCTATAAATGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026873.1-1300s1c1
Sequence:CCGGCCAGAGAAATGGGAAGAGCTACTCGAGTAGCTCTTCCCATTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026873
PTCD2 MISSION shRNA Lentiviral Transduction Particles
pentatricopeptide repeat domain 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026873.2-1426s21c1
Sequence:CCGGGTACCCACAGACGGGATTTCTCTCGAGAGAAATCCCGTCTGTGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-314s21c1
Sequence:CCGGAGCTGGCGAAAGCCGTCATTTCTCGAGAAATGACGGCTTTCGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-662s21c1
Sequence:CCGGTAAGAGAAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTTCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-163s1c1
Sequence:CCGGCAACATAAGAAGATAGCTATTCTCGAGAATAGCTATCTTCTTATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-822s1c1
Sequence:CCGGGATCCACATCCAGTCAAATATCTCGAGATATTTGACTGGATGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.2-627s1c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-1002s21c1
Sequence:CCGGGCTGCACGTGAACGGTCAAATCTCGAGATTTGACCGTTCACGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026873.2-627s21c1
Sequence:CCGGGAATACCCTGGAATCGCTTAACTCGAGTTAAGCGATTCCAGGGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-787s1c1
Sequence:CCGGCCAGAAAGCATAGTGTGTATTCTCGAGAATACACACTATGCTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026873.1-325s1c1
Sequence:CCGGGCCGTCATTTATAGGTACCATCTCGAGATGGTACCTATAAATGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026873.1-1300s1c1
Sequence:CCGGCCAGAGAAATGGGAAGAGCTACTCGAGTAGCTCTTCCCATTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024754
PTCD2 MISSION shRNA Bacterial Glycerol Stock
pentatricopeptide repeat domain 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024754.2-674s1c1
Sequence:CCGGGAAGCTCTACTCAAAGGAGAACTCGAGTTCTCCTTTGAGTAGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-571s1c1
Sequence:CCGGCCAAGATGTGAAGTTCACCAACTCGAGTTGGTGAACTTCACATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-739s1c1
Sequence:CCGGGAATCAGAATGAGATGGCAAACTCGAGTTTGCCATCTCATTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-728s1c1
Sequence:CCGGGCATTAGCTCTGAATCAGAATCTCGAGATTCTGATTCAGAGCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-677s1c1
Sequence:CCGGGCTCTACTCAAAGGAGAAATTCTCGAGAATTTCTCCTTTGAGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024754.2-1806s1c1
Sequence:CCGGGCAGCTCTTAAGAAACAGAATCTCGAGATTCTGTTTCTTAAGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024754
PTCD2 MISSION shRNA shRNA Plasmid DNA
pentatricopeptide repeat domain 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024754.2-674s1c1
Sequence:CCGGGAAGCTCTACTCAAAGGAGAACTCGAGTTCTCCTTTGAGTAGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-571s1c1
Sequence:CCGGCCAAGATGTGAAGTTCACCAACTCGAGTTGGTGAACTTCACATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-739s1c1
Sequence:CCGGGAATCAGAATGAGATGGCAAACTCGAGTTTGCCATCTCATTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-728s1c1
Sequence:CCGGGCATTAGCTCTGAATCAGAATCTCGAGATTCTGATTCAGAGCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-677s1c1
Sequence:CCGGGCTCTACTCAAAGGAGAAATTCTCGAGAATTTCTCCTTTGAGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024754.2-1806s1c1
Sequence:CCGGGCAGCTCTTAAGAAACAGAATCTCGAGATTCTGTTTCTTAAGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024754
PTCD2 MISSION shRNA Lentiviral Transduction Particles
pentatricopeptide repeat domain 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024754.2-674s1c1
Sequence:CCGGGAAGCTCTACTCAAAGGAGAACTCGAGTTCTCCTTTGAGTAGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-571s1c1
Sequence:CCGGCCAAGATGTGAAGTTCACCAACTCGAGTTGGTGAACTTCACATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-739s1c1
Sequence:CCGGGAATCAGAATGAGATGGCAAACTCGAGTTTGCCATCTCATTCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-728s1c1
Sequence:CCGGGCATTAGCTCTGAATCAGAATCTCGAGATTCTGATTCAGAGCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024754.2-677s1c1
Sequence:CCGGGCTCTACTCAAAGGAGAAATTCTCGAGAATTTCTCCTTTGAGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024754.2-1806s1c1
Sequence:CCGGGCAGCTCTTAAGAAACAGAATCTCGAGATTCTGTTTCTTAAGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)