EMAIL THIS PAGE TO A FRIEND

PTCD3

pentatricopeptide repeat domain 3

61 Gene Product Result for
Gene ID:
Mouse(69956) pentatricopeptide repeat domain 3
Rat(500199) Pentatricopeptide repeat domain 3
Zebrafish(553325) pentatricopeptide repeat domain 3
domestic cat(101087571) pentatricopeptide repeat domain 3
dog(475765) pentatricopeptide repeat domain 3
chicken(422911) Pentatricopeptide repeat domain 3
naked mole-rat(101697820) pentatricopeptide repeat domain 3
domestic guinea pig(100728326) pentatricopeptide repeat domain 3
cow(509502) Pentatricopeptide repeat domain 3
sheep(101105643) pentatricopeptide repeat domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017952 Rosetta Predictions human pricing
NM_001134718 Rosetta Predictions rat pricing
XM_001063161 Rosetta Predictions rat pricing
NM_027275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160423 predicted 1852
2 SASI_Hs01_00160424 predicted 1380
3 SASI_Hs01_00160425 predicted 1588
4 SASI_Hs01_00160426 predicted 2131
5 SASI_Hs01_00160428 predicted 1697
6 SASI_Hs01_00160429 predicted 798
7 SASI_Hs02_00350982 predicted 501
8 SASI_Hs01_00160430 predicted 2013
9 SASI_Hs01_00160431 predicted 1293
10 SASI_Hs01_00160432 predicted 835
11 SASI_Hs01_00160427 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258164 predicted 914
2 SASI_Rn02_00258165 predicted 1184
3 SASI_Rn02_00258166 predicted 234
4 SASI_Rn02_00258167 predicted 1039
5 SASI_Rn02_00258168 predicted 1406
6 SASI_Rn02_00258169 predicted 296
7 SASI_Rn02_00258170 predicted 851
8 SASI_Rn02_00258171 predicted 864
9 SASI_Rn02_00258172 predicted 444
10 SASI_Rn02_00258173 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306037 predicted 916
2 SASI_Rn02_00306038 predicted 1181
3 SASI_Rn02_00306039 predicted 236
4 SASI_Rn02_00306040 predicted 1042
5 SASI_Rn02_00306041 predicted 1399
6 SASI_Rn02_00306042 predicted 298
7 SASI_Rn02_00306043 predicted 850
8 SASI_Rn02_00306044 predicted 864
9 SASI_Rn02_00306045 predicted 446
10 SASI_Rn02_00306046 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047420 predicted 871
2 SASI_Mm01_00047421 predicted 954
3 SASI_Mm01_00047422 predicted 1372
4 SASI_Mm01_00047423 predicted 1743
5 SASI_Mm02_00331862 predicted 1457
6 SASI_Mm02_00331863 predicted 2105
7 SASI_Mm01_00047424 predicted 1126
8 SASI_Mm01_00047425 predicted 463
9 SASI_Mm01_00047426 predicted 2134
10 SASI_Mm01_00047429 predicted 219
11 SASI_Mm01_00047427 predicted 887
12 SASI_Mm01_00047428 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027275
VALIDATED
PTCD3 MISSION shRNA Bacterial Glycerol Stock
pentatricopeptide repeat domain 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1187s1c1
Sequence:CCGGCCATCCCTCATCATCTATGATCTCGAGATCATAGATGATGAGGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1959s1c1
Sequence:CCGGCCCAAAGAGTAGTGATGGATTCTCGAGAATCCATCACTACTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-155s1c1
Sequence:CCGGCCAAAGGTTGAAGGATCAGATCTCGAGATCTGATCCTTCAACCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027275.2-248s1c1
Sequence:CCGGGCATCCACAGTAAACAGGGATCTCGAGATCCCTGTTTACTGTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027275
VALIDATED
PTCD3 MISSION shRNA shRNA Plasmid DNA
pentatricopeptide repeat domain 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1187s1c1
Sequence:CCGGCCATCCCTCATCATCTATGATCTCGAGATCATAGATGATGAGGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1959s1c1
Sequence:CCGGCCCAAAGAGTAGTGATGGATTCTCGAGAATCCATCACTACTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-155s1c1
Sequence:CCGGCCAAAGGTTGAAGGATCAGATCTCGAGATCTGATCCTTCAACCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027275.2-248s1c1
Sequence:CCGGGCATCCACAGTAAACAGGGATCTCGAGATCCCTGTTTACTGTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027275
VALIDATED
PTCD3 MISSION shRNA Lentiviral Transduction Particles
pentatricopeptide repeat domain 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1187s1c1
Sequence:CCGGCCATCCCTCATCATCTATGATCTCGAGATCATAGATGATGAGGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-1959s1c1
Sequence:CCGGCCCAAAGAGTAGTGATGGATTCTCGAGAATCCATCACTACTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027275.2-155s1c1
Sequence:CCGGCCAAAGGTTGAAGGATCAGATCTCGAGATCTGATCCTTCAACCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027275.2-248s1c1
Sequence:CCGGGCATCCACAGTAAACAGGGATCTCGAGATCCCTGTTTACTGTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017952
VALIDATED
PTCD3 MISSION shRNA Bacterial Glycerol Stock
pentatricopeptide repeat domain 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1546s1c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1970s1c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017952.4-841s1c1
Sequence:CCGGCGAGCTTATGAGCAGGCATTACTCGAGTAATGCCTGCTCATAAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1473s1c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017952.4-2017s1c1
Sequence:CCGGGCCCTAAGTAATCTAACTGCACTCGAGTGCAGTTAGATTACTTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1690s1c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017952.4-4437s1c1
Sequence:CCGGCCACAGAGTTACATTACCAATCTCGAGATTGGTAATGTAACTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-2003s21c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1579s21c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1506s21c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1723s21c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017952
VALIDATED
PTCD3 MISSION shRNA shRNA Plasmid DNA
pentatricopeptide repeat domain 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1546s1c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1970s1c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017952.4-841s1c1
Sequence:CCGGCGAGCTTATGAGCAGGCATTACTCGAGTAATGCCTGCTCATAAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1473s1c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017952.4-2017s1c1
Sequence:CCGGGCCCTAAGTAATCTAACTGCACTCGAGTGCAGTTAGATTACTTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1690s1c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017952.4-4437s1c1
Sequence:CCGGCCACAGAGTTACATTACCAATCTCGAGATTGGTAATGTAACTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-2003s21c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1579s21c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1506s21c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1723s21c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017952
VALIDATED
PTCD3 MISSION shRNA Lentiviral Transduction Particles
pentatricopeptide repeat domain 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1546s1c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1970s1c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017952.4-841s1c1
Sequence:CCGGCGAGCTTATGAGCAGGCATTACTCGAGTAATGCCTGCTCATAAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1473s1c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017952.4-2017s1c1
Sequence:CCGGGCCCTAAGTAATCTAACTGCACTCGAGTGCAGTTAGATTACTTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017952.4-1690s1c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017952.4-4437s1c1
Sequence:CCGGCCACAGAGTTACATTACCAATCTCGAGATTGGTAATGTAACTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-2003s21c1
Sequence:CCGGCCCAGAGAGTAATGAGTGATTCTCGAGAATCACTCATTACTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1579s21c1
Sequence:CCGGCGGCTAGAAGTGATTCCTAAACTCGAGTTTAGGAATCACTTCTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1506s21c1
Sequence:CCGGCCTGATACCTTCAGCCTACTTCTCGAGAAGTAGGCTGAAGGTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017952.5-1723s21c1
Sequence:CCGGGCTGATATCAAATCTGCGTATCTCGAGATACGCAGATTTGATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)