EMAIL THIS PAGE TO A FRIEND

PTCH1

patched 1

178 Gene Product Result for
Synonyms: BCNS HPE7 NBCCS PTC PTC1 PTCH PTCH11
Gene ID:
Human(5727) Summary: This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
Mouse(19206) patched homolog 1
Rat(89830) patched 1
cow(520994) patched 1
sheep(101112193) patched 1
Zebrafish(30189) patched 1
Horse(100033936) patched 1
dog(484137) patched 1
chicken(395806) patched 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P0088 Anti-Patch1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502472 Anti-PATCHED, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2500835 Anti-PTCH (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1411779 ANTI-PTCH antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411866 ANTI-PTCH antibody produced in mouse clone 8A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411867 ANTI-PTCH antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411868 ANTI-PTCH antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1411869 ANTI-PTCH antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411871 ANTI-PTCH antibody produced in mouse clone 3B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411872 ANTI-PTCH antibody produced in mouse clone 4F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
T5453 Anti-PTCH1 (946-960) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501613 Anti-PTCH1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
AV44249 Anti-PTCH1 antibody produced in rabbit affinity isolated antibody rabbit, horse, zebrafish, guinea pig, rat, human, canine, mouse
immunohistochemistry, western blot pricing
HPA075072 Anti-PTCH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB3300109 Monoclonal Anti-Patched1 antibody produced in mouse clone 3c2, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB3300110 Monoclonal Anti-Patched1 antibody produced in mouse clone 5c7, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0005727M2 Monoclonal Anti-PTCH antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404271 Monoclonal Anti-PTCH antibody produced in mouse clone 8E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000264 Rosetta Predictions human pricing
NM_001083602 Rosetta Predictions human pricing
NM_001083603 Rosetta Predictions human pricing
NM_001083604 Rosetta Predictions human pricing
NM_001083605 Rosetta Predictions human pricing
NM_001083606 Rosetta Predictions human pricing
NM_001083607 Rosetta Predictions human pricing
NM_053566 Rosetta Predictions rat pricing
NM_008957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030419 predicted 2856
2 SASI_Hs01_00030420 predicted 2616
3 SASI_Hs01_00030421 predicted 1170
4 SASI_Hs01_00030423 predicted 3023
5 SASI_Hs01_00030424 predicted 3104
6 SASI_Hs01_00030426 predicted 2621
7 SASI_Hs02_00302210 predicted 2653
8 SASI_Hs01_00030427 predicted 3848
9 SASI_Hs01_00030428 predicted 2805
10 SASI_Hs02_00302211 predicted 1957
11 SASI_Hs01_00030422 predicted 829
12 SASI_Hs01_00030425 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317041 predicted 2964
2 SASI_Hs02_00317042 predicted 2720
3 SASI_Hs02_00317043 predicted 1278
4 SASI_Hs02_00317044 predicted 3131
5 SASI_Hs02_00317045 predicted 3219
6 SASI_Hs02_00317046 predicted 2730
7 SASI_Hs02_00317047 predicted 2765
8 SASI_Hs02_00317048 predicted 3959
9 SASI_Hs02_00317049 predicted 2917
10 SASI_Hs02_00317050 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317051 predicted 2813
2 SASI_Hs02_00317052 predicted 2561
3 SASI_Hs02_00317053 predicted 1118
4 SASI_Hs02_00317054 predicted 2977
5 SASI_Hs02_00317055 predicted 3058
6 SASI_Hs02_00317056 predicted 2575
7 SASI_Hs02_00317057 predicted 2604
8 SASI_Hs02_00317058 predicted 3804
9 SASI_Hs02_00317059 predicted 2758
10 SASI_Hs02_00317060 predicted 1913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317061 predicted 2580
2 SASI_Hs02_00317062 predicted 2330
3 SASI_Hs02_00317063 predicted 888
4 SASI_Hs02_00317064 predicted 2734
5 SASI_Hs02_00317065 predicted 2827
6 SASI_Hs02_00317066 predicted 2337
7 SASI_Hs02_00317067 predicted 2374
8 SASI_Hs02_00317068 predicted 3570
9 SASI_Hs02_00317069 predicted 2527
10 SASI_Hs02_00317070 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317071 predicted 2562
2 SASI_Hs02_00317072 predicted 2316
3 SASI_Hs02_00317073 predicted 864
4 SASI_Hs02_00317074 predicted 2716
5 SASI_Hs02_00317075 predicted 2808
6 SASI_Hs02_00317076 predicted 2318
7 SASI_Hs02_00317077 predicted 2358
8 SASI_Hs02_00317078 predicted 3557
9 SASI_Hs02_00317079 predicted 2504
10 SASI_Hs02_00317080 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317081 predicted 2660
2 SASI_Hs02_00317082 predicted 2412
3 SASI_Hs02_00317083 predicted 972
4 SASI_Hs02_00317084 predicted 2815
5 SASI_Hs02_00317085 predicted 2908
6 SASI_Hs02_00317086 predicted 2418
7 SASI_Hs02_00317087 predicted 2454
8 SASI_Hs02_00317088 predicted 3654
9 SASI_Hs02_00317089 predicted 2602
10 SASI_Hs02_00317090 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317091 predicted 2739
2 SASI_Hs02_00317092 predicted 2483
3 SASI_Hs02_00317093 predicted 1039
4 SASI_Hs02_00317094 predicted 2890
5 SASI_Hs02_00317095 predicted 2981
6 SASI_Hs02_00317096 predicted 2498
7 SASI_Hs02_00317097 predicted 2529
8 SASI_Hs02_00317098 predicted 3727
9 SASI_Hs02_00317099 predicted 2676
10 SASI_Hs02_00317100 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041467 predicted 1736
2 SASI_Rn01_00041468 predicted 594
3 SASI_Rn01_00041469 predicted 2479
4 SASI_Rn01_00041471 predicted 1094
5 SASI_Rn01_00041472 predicted 940
6 SASI_Rn01_00041473 predicted 1031
7 SASI_Rn01_00041475 predicted 620
8 SASI_Rn01_00041476 predicted 2645
9 SASI_Rn02_00266226 predicted 2556
10 SASI_Rn02_00266227 predicted 2735
11 SASI_Rn01_00041470 predicted 1861
12 SASI_Rn01_00041474 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113780 predicted 2384
2 SASI_Mm01_00113781 predicted 1035
3 SASI_Mm01_00113782 predicted 1089
4 SASI_Mm01_00113783 predicted 935
5 SASI_Mm01_00113784 predicted 2481
6 SASI_Mm01_00113785 predicted 2630
7 SASI_Mm01_00113786 predicted 615
8 SASI_Mm01_00113787 predicted 2644
9 SASI_Mm02_00315027 predicted 3109
10 SASI_Mm02_00315028 predicted 2195
11 SASI_Mm01_00113788 predicted 1734
12 SASI_Mm01_00113789 predicted 2558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008957
VALIDATED
PTCH1 MISSION shRNA Bacterial Glycerol Stock
patched 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-1735s21c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-2395s21c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-543s21c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-3472s21c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1421s1c1
Sequence:CCGGGCTCCTTGATTGGCATTTCTTCTCGAGAAGAAATGCCAATCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008957.1-3472s1c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-2395s1c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-543s1c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1735s1c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008957
VALIDATED
PTCH1 MISSION shRNA shRNA Plasmid DNA
patched 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-1735s21c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-2395s21c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-543s21c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-3472s21c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1421s1c1
Sequence:CCGGGCTCCTTGATTGGCATTTCTTCTCGAGAAGAAATGCCAATCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008957.1-3472s1c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-2395s1c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-543s1c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1735s1c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008957
VALIDATED
PTCH1 MISSION shRNA Lentiviral Transduction Particles
patched 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-1735s21c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-2395s21c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-543s21c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008957.2-3472s21c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1421s1c1
Sequence:CCGGGCTCCTTGATTGGCATTTCTTCTCGAGAAGAAATGCCAATCAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008957.1-3472s1c1
Sequence:CCGGCCTGTCCTCTTATCCTTCTTTCTCGAGAAAGAAGGATAAGAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-2395s1c1
Sequence:CCGGCCGAATATCCAGCACCTACTTCTCGAGAAGTAGGTGCTGGATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-543s1c1
Sequence:CCGGGCAATGGAAGTTGGAACATTTCTCGAGAAATGTTCCAACTTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008957.1-1735s1c1
Sequence:CCGGCCTGCAATTCTCAGCATGGATCTCGAGATCCATGCTGAGAATTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000264
VALIDATED
PTCH1 MISSION shRNA Bacterial Glycerol Stock
patched 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-4523s21c1
Sequence:CCGGCTCCAACTGAGGGTGATTAAACTCGAGTTTAATCACCCTCAGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-7346s21c1
Sequence:CCGGAGTGGATATTCATGCGATTATCTCGAGATAATCGCATGAATATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2077s21c1
Sequence:CCGGACACCGACACACACGACAATACTCGAGTATTGTCGTGTGTGTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2880s21c1
Sequence:CCGGGACATCAGCCAGTTGACTAAACTCGAGTTTAGTCAACTGGCTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-647s1c1
Sequence:CCGGTAATCCTCAACTCATGATACACTCGAGTGTATCATGAGTTGAGGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-3613s1c1
Sequence:CCGGATCTGAGTTCGACTTCATTGCTCGAGCAATGAAGTCGAACTCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1646s1c1
Sequence:CCGGCCTGTGCTCATTGATCGGAATCTCGAGATTCCGATCAATGAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000264.2-6645s1c1
Sequence:CCGGCCCTGATTTCTGCATGGTGTACTCGAGTACACCATGCAGAAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1134s1c1
Sequence:CCGGCCTCTTGATATGGCCCTTGTTCTCGAGAACAAGGGCCATATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000264.2-429s1c1
Sequence:CCGGGCGAAGTTTCAGAGACTCTTACTCGAGTAAGAGTCTCTGAAACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000264
VALIDATED
PTCH1 MISSION shRNA shRNA Plasmid DNA
patched 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-4523s21c1
Sequence:CCGGCTCCAACTGAGGGTGATTAAACTCGAGTTTAATCACCCTCAGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-7346s21c1
Sequence:CCGGAGTGGATATTCATGCGATTATCTCGAGATAATCGCATGAATATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2077s21c1
Sequence:CCGGACACCGACACACACGACAATACTCGAGTATTGTCGTGTGTGTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2880s21c1
Sequence:CCGGGACATCAGCCAGTTGACTAAACTCGAGTTTAGTCAACTGGCTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-647s1c1
Sequence:CCGGTAATCCTCAACTCATGATACACTCGAGTGTATCATGAGTTGAGGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-3613s1c1
Sequence:CCGGATCTGAGTTCGACTTCATTGCTCGAGCAATGAAGTCGAACTCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1646s1c1
Sequence:CCGGCCTGTGCTCATTGATCGGAATCTCGAGATTCCGATCAATGAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000264.2-6645s1c1
Sequence:CCGGCCCTGATTTCTGCATGGTGTACTCGAGTACACCATGCAGAAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1134s1c1
Sequence:CCGGCCTCTTGATATGGCCCTTGTTCTCGAGAACAAGGGCCATATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000264.2-429s1c1
Sequence:CCGGGCGAAGTTTCAGAGACTCTTACTCGAGTAAGAGTCTCTGAAACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000264
VALIDATED
PTCH1 MISSION shRNA Lentiviral Transduction Particles
patched 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-4523s21c1
Sequence:CCGGCTCCAACTGAGGGTGATTAAACTCGAGTTTAATCACCCTCAGTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-7346s21c1
Sequence:CCGGAGTGGATATTCATGCGATTATCTCGAGATAATCGCATGAATATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2077s21c1
Sequence:CCGGACACCGACACACACGACAATACTCGAGTATTGTCGTGTGTGTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000264.3-2880s21c1
Sequence:CCGGGACATCAGCCAGTTGACTAAACTCGAGTTTAGTCAACTGGCTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-647s1c1
Sequence:CCGGTAATCCTCAACTCATGATACACTCGAGTGTATCATGAGTTGAGGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.x-3613s1c1
Sequence:CCGGATCTGAGTTCGACTTCATTGCTCGAGCAATGAAGTCGAACTCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1646s1c1
Sequence:CCGGCCTGTGCTCATTGATCGGAATCTCGAGATTCCGATCAATGAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000264.2-6645s1c1
Sequence:CCGGCCCTGATTTCTGCATGGTGTACTCGAGTACACCATGCAGAAATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000264.2-1134s1c1
Sequence:CCGGCCTCTTGATATGGCCCTTGTTCTCGAGAACAAGGGCCATATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000264.2-429s1c1
Sequence:CCGGGCGAAGTTTCAGAGACTCTTACTCGAGTAAGAGTCTCTGAAACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)