EMAIL THIS PAGE TO A FRIEND

PTCH2

patched 2

50 Gene Product Result for
Synonyms: PTC2
UniProtKB ID: Q9Y6C5, O95341, O95856, Q53Z57, Q5QP87, Q6UX14
Gene ID:
Human(8643) Summary: This gene encodes a transmembrane receptor of the patched gene family. The encoded protein may function as a tumor suppressor in the hedgehog signaling pathway. Alterations in this gene have been associated with nevoid basal cell carcinoma syndrome, basal cell carcinoma, medulloblastoma, and susceptibility to congenital macrostomia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Oct 2009]
Mouse(19207) patched homolog 2
Rat(366452) patched homolog 2 (Drosophila)
Zebrafish(30181) patched 2
chicken(374187) patched 2
Horse(100052702) patched 2
dog(482519) patched 2
cow(507948) patched 2
sheep(101110291) patched 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088131 MISSION® esiRNA esiRNA targeting mouse Ptch2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003738 Rosetta Predictions human pricing
NM_001108975 Rosetta Predictions rat pricing
NM_008958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148675 predicted 2015
2 SASI_Hs01_00148676 predicted 3243
3 SASI_Hs01_00148677 predicted 1510
4 SASI_Hs01_00148678 predicted 1807
5 SASI_Hs01_00148679 predicted 3079
6 SASI_Hs01_00148680 predicted 246
7 SASI_Hs02_00336193 predicted 2656
8 SASI_Hs02_00336194 predicted 236
9 SASI_Hs01_00148682 predicted 1015
10 SASI_Hs01_00148683 predicted 2355
11 SASI_Hs01_00148681 predicted 240
12 SASI_Hs01_00148684 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243934 predicted 4045
2 SASI_Rn02_00243935 predicted 4001
3 SASI_Rn02_00243936 predicted 3785
4 SASI_Rn02_00243937 predicted 3714
5 SASI_Rn02_00243938 predicted 3648
6 SASI_Rn02_00243939 predicted 3682
7 SASI_Rn02_00243940 predicted 3649
8 SASI_Rn02_00243941 predicted 3839
9 SASI_Rn02_00243942 predicted 3754
10 SASI_Rn02_00243943 predicted 3944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080199 predicted 242
2 SASI_Mm01_00080200 predicted 3078
3 SASI_Mm02_00315029 predicted 1593
4 SASI_Mm01_00080202 predicted 2419
5 SASI_Mm01_00080203 predicted 3238
6 SASI_Mm01_00080205 predicted 2013
7 SASI_Mm01_00080206 predicted 3047
8 SASI_Mm02_00315030 predicted 3002
9 SASI_Mm01_00080207 predicted 622
10 SASI_Mm01_00080208 predicted 450
11 SASI_Mm01_00080201 predicted 450
12 SASI_Mm01_00080204 predicted 3068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003738
PTCH2 MISSION shRNA Bacterial Glycerol Stock
patched 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3248s1c1
Sequence:CCGGCCCACTTTGACTTCATTGTAACTCGAGTTACAATGAAGTCAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-227s21c1
Sequence:CCGGGTCTCCGCATGGCCATTATTGCTCGAGCAATAATGGCCATGCGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3363s1c1
Sequence:CCGGGCCAGAGGTGATACAGATGTACTCGAGTACATCTGTATCACCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-300s1c1
Sequence:CCGGGCTGCATTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-534s1c1
Sequence:CCGGGCAGATGATTGAGAAGCTGTTCTCGAGAACAGCTTCTCAATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-1518s1c1
Sequence:CCGGCGTACTCACATCCATCAACAACTCGAGTTGTTGATGGATGTGAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-435s21c1
Sequence:CCGGTGCCAGTAAAGTCCAAGTATCCTCGAGGATACTTGGACTTTACTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-2660s21c1
Sequence:CCGGCTGAATGGCTGCACGACAAATCTCGAGATTTGTCGTGCAGCCATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-3249s21c1
Sequence:GTACCGGCCACTTTGACTTCATTGTAAGCTCGAGCTTACAATGAAGTCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-1016s21c1
Sequence:GTACCGGACTATCAGACACATGACATTGCTCGAGCAATGTCATGTGTCTGATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003738
PTCH2 MISSION shRNA shRNA Plasmid DNA
patched 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3248s1c1
Sequence:CCGGCCCACTTTGACTTCATTGTAACTCGAGTTACAATGAAGTCAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-227s21c1
Sequence:CCGGGTCTCCGCATGGCCATTATTGCTCGAGCAATAATGGCCATGCGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3363s1c1
Sequence:CCGGGCCAGAGGTGATACAGATGTACTCGAGTACATCTGTATCACCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-300s1c1
Sequence:CCGGGCTGCATTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-534s1c1
Sequence:CCGGGCAGATGATTGAGAAGCTGTTCTCGAGAACAGCTTCTCAATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-1518s1c1
Sequence:CCGGCGTACTCACATCCATCAACAACTCGAGTTGTTGATGGATGTGAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-435s21c1
Sequence:CCGGTGCCAGTAAAGTCCAAGTATCCTCGAGGATACTTGGACTTTACTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-2660s21c1
Sequence:CCGGCTGAATGGCTGCACGACAAATCTCGAGATTTGTCGTGCAGCCATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-3249s21c1
Sequence:GTACCGGCCACTTTGACTTCATTGTAAGCTCGAGCTTACAATGAAGTCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-1016s21c1
Sequence:GTACCGGACTATCAGACACATGACATTGCTCGAGCAATGTCATGTGTCTGATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003738
PTCH2 MISSION shRNA Lentiviral Transduction Particles
patched 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3248s1c1
Sequence:CCGGCCCACTTTGACTTCATTGTAACTCGAGTTACAATGAAGTCAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-227s21c1
Sequence:CCGGGTCTCCGCATGGCCATTATTGCTCGAGCAATAATGGCCATGCGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-3363s1c1
Sequence:CCGGGCCAGAGGTGATACAGATGTACTCGAGTACATCTGTATCACCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-300s1c1
Sequence:CCGGGCTGCATTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-534s1c1
Sequence:CCGGGCAGATGATTGAGAAGCTGTTCTCGAGAACAGCTTCTCAATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003738.2-1518s1c1
Sequence:CCGGCGTACTCACATCCATCAACAACTCGAGTTGTTGATGGATGTGAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-435s21c1
Sequence:CCGGTGCCAGTAAAGTCCAAGTATCCTCGAGGATACTTGGACTTTACTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-2660s21c1
Sequence:CCGGCTGAATGGCTGCACGACAAATCTCGAGATTTGTCGTGCAGCCATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-3249s21c1
Sequence:GTACCGGCCACTTTGACTTCATTGTAAGCTCGAGCTTACAATGAAGTCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003738.3-1016s21c1
Sequence:GTACCGGACTATCAGACACATGACATTGCTCGAGCAATGTCATGTGTCTGATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008958
PTCH2 MISSION shRNA Bacterial Glycerol Stock
patched 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-2017s1c1
Sequence:CCGGCGCTATCAGTTTGCACCTTTACTCGAGTAAAGGTGCAAACTGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-3006s1c1
Sequence:CCGGGCTCTTTGGTATCATGGGATTCTCGAGAATCCCATGATACCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-226s1c1
Sequence:CCGGGCTGTAATTGAGACAGACCTACTCGAGTAGGTCTGTCTCAATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-523s1c1
Sequence:CCGGCGGATGATTGAGAAGCTGTTTCTCGAGAAACAGCTTCTCAATCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-109s1c1
Sequence:CCGGCGAGCTTACTTCCAAGGTCTACTCGAGTAGACCTTGGAAGTAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008958
PTCH2 MISSION shRNA shRNA Plasmid DNA
patched 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-2017s1c1
Sequence:CCGGCGCTATCAGTTTGCACCTTTACTCGAGTAAAGGTGCAAACTGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-3006s1c1
Sequence:CCGGGCTCTTTGGTATCATGGGATTCTCGAGAATCCCATGATACCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-226s1c1
Sequence:CCGGGCTGTAATTGAGACAGACCTACTCGAGTAGGTCTGTCTCAATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-523s1c1
Sequence:CCGGCGGATGATTGAGAAGCTGTTTCTCGAGAAACAGCTTCTCAATCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-109s1c1
Sequence:CCGGCGAGCTTACTTCCAAGGTCTACTCGAGTAGACCTTGGAAGTAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008958
PTCH2 MISSION shRNA Lentiviral Transduction Particles
patched 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-2017s1c1
Sequence:CCGGCGCTATCAGTTTGCACCTTTACTCGAGTAAAGGTGCAAACTGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-3006s1c1
Sequence:CCGGGCTCTTTGGTATCATGGGATTCTCGAGAATCCCATGATACCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-226s1c1
Sequence:CCGGGCTGTAATTGAGACAGACCTACTCGAGTAGGTCTGTCTCAATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-523s1c1
Sequence:CCGGCGGATGATTGAGAAGCTGTTTCTCGAGAAACAGCTTCTCAATCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008958.1-109s1c1
Sequence:CCGGCGAGCTTACTTCCAAGGTCTACTCGAGTAGACCTTGGAAGTAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)