EMAIL THIS PAGE TO A FRIEND

PTCHD2

patched domain containing 2

76 Gene Product Result for
Synonyms: DISP3
UniProtKB ID: Q9P2K9, Q5VTU9, Q9UJD6
Gene ID:
Mouse(242748) patched domain containing 2
Rat(313705) patched domain containing 2
Zebrafish(100535855) patched domain containing 2
chicken(419497) patched domain containing 2
dog(608490) patched domain containing 2
Horse(100056461) patched domain containing 2
domestic cat(101098645) patched domain containing 2
naked mole-rat(101724517) patched domain containing 2
domestic guinea pig(100717282) patched domain containing 2
cow(616017) patched domain containing 2
sheep(101112836) patched domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001083342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001083342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001083342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020780 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020780 Rosetta Predictions human pricing
XM_052561 Rosetta Predictions human pricing
NM_001107992 Rosetta Predictions rat pricing
NM_001083342 Rosetta Predictions mouse pricing
XM_620145 Rosetta Predictions mouse pricing
XM_894941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353928 predicted 1899
2 SASI_Hs02_00353929 predicted 2660
3 SASI_Hs02_00353930 predicted 2882
4 SASI_Hs02_00353931 predicted 1787
5 SASI_Hs02_00353932 predicted 192
6 SASI_Hs02_00353933 predicted 2307
7 SASI_Hs02_00353934 predicted 695
8 SASI_Hs02_00353935 predicted 3030
9 SASI_Hs02_00353936 predicted 2658
10 SASI_Hs02_00353937 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_052561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298888 predicted 2348
2 SASI_Hs01_00298889 predicted 3106
3 SASI_Hs01_00298890 predicted 3330
4 SASI_Hs01_00298891 predicted 2241
5 SASI_Hs01_00298892 predicted 852
6 SASI_Hs01_00298893 predicted 2760
7 SASI_Hs01_00298894 predicted 1140
8 SASI_Hs01_00298895 predicted 3478
9 SASI_Hs01_00298896 predicted 1712
10 SASI_Hs01_00298897 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234295 predicted 2839
2 SASI_Rn02_00234296 predicted 2690
3 SASI_Rn02_00234297 predicted 2105
4 SASI_Rn02_00234298 predicted 3488
5 SASI_Rn02_00234299 predicted 2979
6 SASI_Rn02_00234300 predicted 3904
7 SASI_Rn02_00234301 predicted 2117
8 SASI_Rn02_00234302 predicted 3305
9 SASI_Rn02_00234303 predicted 2433
10 SASI_Rn02_00234304 predicted 2471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299701 predicted 2265
2 SASI_Mm02_00299702 predicted 870
3 SASI_Mm02_00299703 predicted 1416
4 SASI_Mm02_00299704 predicted 1992
5 SASI_Mm02_00299705 predicted 3066
6 SASI_Mm02_00299706 predicted 3520
7 SASI_Mm02_00299707 predicted 1638
8 SASI_Mm02_00299708 predicted 1328
9 SASI_Mm02_00299709 predicted 3331
10 SASI_Mm02_00299710 predicted 1828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211146 predicted 3505
2 SASI_Mm01_00211147 predicted 882
3 SASI_Mm01_00211148 predicted 1426
4 SASI_Mm01_00211149 predicted 1116
5 SASI_Mm01_00211150 predicted 1997
6 SASI_Mm01_00211151 predicted 1620
7 SASI_Mm01_00211152 predicted 3552
8 SASI_Mm01_00211153 predicted 1653
9 SASI_Mm01_00211154 predicted 1675
10 SASI_Mm01_00211155 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206597 predicted 2277
2 SASI_Mm01_00206598 predicted 883
3 SASI_Mm01_00206599 predicted 1423
4 SASI_Mm01_00206600 predicted 1118
5 SASI_Mm01_00206601 predicted 1994
6 SASI_Mm01_00206602 predicted 1611
7 SASI_Mm01_00206603 predicted 3521
8 SASI_Mm01_00206604 predicted 1644
9 SASI_Mm01_00206605 predicted 1677
10 SASI_Mm01_00206606 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083342
PTCHD2 MISSION shRNA Bacterial Glycerol Stock
patched domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3475s21c1
Sequence:CCGGGCCTTTGAGTCGACCACATACCTCGAGGTATGTGGTCGACTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1003s21c1
Sequence:CCGGATCCACGAGATCGAGCGTAAACTCGAGTTTACGCTCGATCTCGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1473s21c1
Sequence:CCGGGGTACGCCGAACCTTCAATAACTCGAGTTATTGAAGGTTCGGCGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3184s21c1
Sequence:CCGGCAGATGGACAACCACGTTATCCTCGAGGATAACGTGGTTGTCCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083342.1-6492s21c1
Sequence:CCGGTGTCAGATTGACAGCATATTTCTCGAGAAATATGCTGTCAATCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083342
PTCHD2 MISSION shRNA shRNA Plasmid DNA
patched domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3475s21c1
Sequence:CCGGGCCTTTGAGTCGACCACATACCTCGAGGTATGTGGTCGACTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1003s21c1
Sequence:CCGGATCCACGAGATCGAGCGTAAACTCGAGTTTACGCTCGATCTCGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1473s21c1
Sequence:CCGGGGTACGCCGAACCTTCAATAACTCGAGTTATTGAAGGTTCGGCGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3184s21c1
Sequence:CCGGCAGATGGACAACCACGTTATCCTCGAGGATAACGTGGTTGTCCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083342.1-6492s21c1
Sequence:CCGGTGTCAGATTGACAGCATATTTCTCGAGAAATATGCTGTCAATCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083342
PTCHD2 MISSION shRNA Lentiviral Transduction Particles
patched domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3475s21c1
Sequence:CCGGGCCTTTGAGTCGACCACATACCTCGAGGTATGTGGTCGACTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1003s21c1
Sequence:CCGGATCCACGAGATCGAGCGTAAACTCGAGTTTACGCTCGATCTCGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-1473s21c1
Sequence:CCGGGGTACGCCGAACCTTCAATAACTCGAGTTATTGAAGGTTCGGCGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083342.1-3184s21c1
Sequence:CCGGCAGATGGACAACCACGTTATCCTCGAGGATAACGTGGTTGTCCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083342.1-6492s21c1
Sequence:CCGGTGTCAGATTGACAGCATATTTCTCGAGAAATATGCTGTCAATCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020780
PTCHD2 MISSION shRNA Bacterial Glycerol Stock
patched domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1385s21c1
Sequence:CCGGAGGAACAACGGGCTAAGTTTCCTCGAGGAAACTTAGCCCGTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3640s21c1
Sequence:CCGGGAGCACTGGAAGCAGATATTCCTCGAGGAATATCTGCTTCCAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3173s21c1
Sequence:CCGGTTGTGGTCTTCGGCATTATTGCTCGAGCAATAATGCCGAAGACCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1322s21c1
Sequence:CCGGTGCGCAGTGAGATCCTGTTTGCTCGAGCAAACAGGATCTCACTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020780.1-5040s21c1
Sequence:CCGGAGCTTTCCTCATGGATCTAAGCTCGAGCTTAGATCCATGAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020780
PTCHD2 MISSION shRNA shRNA Plasmid DNA
patched domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1385s21c1
Sequence:CCGGAGGAACAACGGGCTAAGTTTCCTCGAGGAAACTTAGCCCGTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3640s21c1
Sequence:CCGGGAGCACTGGAAGCAGATATTCCTCGAGGAATATCTGCTTCCAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3173s21c1
Sequence:CCGGTTGTGGTCTTCGGCATTATTGCTCGAGCAATAATGCCGAAGACCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1322s21c1
Sequence:CCGGTGCGCAGTGAGATCCTGTTTGCTCGAGCAAACAGGATCTCACTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020780.1-5040s21c1
Sequence:CCGGAGCTTTCCTCATGGATCTAAGCTCGAGCTTAGATCCATGAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020780
PTCHD2 MISSION shRNA Lentiviral Transduction Particles
patched domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1385s21c1
Sequence:CCGGAGGAACAACGGGCTAAGTTTCCTCGAGGAAACTTAGCCCGTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3640s21c1
Sequence:CCGGGAGCACTGGAAGCAGATATTCCTCGAGGAATATCTGCTTCCAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-3173s21c1
Sequence:CCGGTTGTGGTCTTCGGCATTATTGCTCGAGCAATAATGCCGAAGACCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020780.1-1322s21c1
Sequence:CCGGTGCGCAGTGAGATCCTGTTTGCTCGAGCAAACAGGATCTCACTGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020780.1-5040s21c1
Sequence:CCGGAGCTTTCCTCATGGATCTAAGCTCGAGCTTAGATCCATGAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)