EMAIL THIS PAGE TO A FRIEND

PTCHD3

patched domain containing 3

58 Gene Product Result for
Synonyms: PTR
UniProtKB ID: Q3KNS1, I3L499, Q6ZU28
Gene ID:
Mouse(74675) patched domain containing 3
Rat(688333) patched domain containing 3
chicken(428417) patched domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001034842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034842 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034842 Rosetta Predictions human pricing
XM_928650 Rosetta Predictions human pricing
XM_001081846 Rosetta Predictions rat pricing
XM_109751 Rosetta Predictions mouse pricing
XM_912872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119287 predicted 1520
2 SASI_Hs01_00119288 predicted 1371
3 SASI_Hs01_00119289 predicted 1770
4 SASI_Hs01_00119290 predicted 2131
5 SASI_Hs01_00119291 predicted 1172
6 SASI_Hs01_00119292 predicted 975
7 SASI_Hs01_00119293 predicted 1508
8 SASI_Hs01_00119294 predicted 1198
9 SASI_Hs01_00119295 predicted 1245
10 SASI_Hs01_00119296 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257859 predicted 1519
2 SASI_Hs01_00257860 predicted 1373
3 SASI_Hs01_00257861 predicted 1471
4 SASI_Hs01_00257862 predicted 1269
5 SASI_Hs01_00257863 predicted 1416
6 SASI_Hs01_00257864 predicted 1507
7 SASI_Hs01_00257865 predicted 1470
8 SASI_Hs01_00257866 predicted 1281
9 SASI_Hs01_00257867 predicted 1522
10 SASI_Hs01_00257868 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373782 predicted 1997
2 SASI_Rn02_00373783 predicted 1784
3 SASI_Rn02_00373784 predicted 1877
4 SASI_Rn02_00373785 predicted 1852
5 SASI_Rn02_00373786 predicted 1963
6 SASI_Rn02_00373787 predicted 1369
7 SASI_Rn02_00373788 predicted 1009
8 SASI_Rn02_00373789 predicted 1817
9 SASI_Rn02_00373790 predicted 943
10 SASI_Rn02_00373791 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274169 predicted 2063
2 SASI_Mm01_00274170 predicted 1096
3 SASI_Mm01_00274171 predicted 1523
4 SASI_Mm01_00274172 predicted 1424
5 SASI_Mm01_00274173 predicted 1868
6 SASI_Mm01_00274174 predicted 1003
7 SASI_Mm01_00274176 predicted 1661
8 SASI_Mm02_00424012 predicted 2489
9 SASI_Mm01_00274177 predicted 2226
10 SASI_Mm01_00274178 predicted 1651
11 SASI_Mm01_00274175 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437351 predicted 2056
2 SASI_Mm02_00437352 predicted 1105
3 SASI_Mm02_00437353 predicted 1531
4 SASI_Mm02_00437354 predicted 1426
5 SASI_Mm02_00437355 predicted 1871
6 SASI_Mm02_00437356 predicted 1002
7 SASI_Mm02_00437357 predicted 1664
8 SASI_Mm02_00437358 predicted 2494
9 SASI_Mm02_00437359 predicted 2222
10 SASI_Mm02_00437360 predicted 1657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029049
PTCHD3 MISSION shRNA Bacterial Glycerol Stock
patched domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2088s21c1
Sequence:CCGGCTAATGACAAGAATACCTTTACTCGAGTAAAGGTATTCTTGTCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029049.1-2986s21c1
Sequence:CCGGGAGGGTAATGTAGGATATAAACTCGAGTTTATATCCTACATTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2282s21c1
Sequence:CCGGGAAGTTCCCTTAATGGTATATCTCGAGATATACCATTAAGGGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2065s21c1
Sequence:CCGGCATGAATAGCAGCGGAAATAACTCGAGTTATTTCCGCTGCTATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-1382s21c1
Sequence:CCGGGAACGACTCTCCAATTCATATCTCGAGATATGAATTGGAGAGTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029049
PTCHD3 MISSION shRNA shRNA Plasmid DNA
patched domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2088s21c1
Sequence:CCGGCTAATGACAAGAATACCTTTACTCGAGTAAAGGTATTCTTGTCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029049.1-2986s21c1
Sequence:CCGGGAGGGTAATGTAGGATATAAACTCGAGTTTATATCCTACATTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2282s21c1
Sequence:CCGGGAAGTTCCCTTAATGGTATATCTCGAGATATACCATTAAGGGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2065s21c1
Sequence:CCGGCATGAATAGCAGCGGAAATAACTCGAGTTATTTCCGCTGCTATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-1382s21c1
Sequence:CCGGGAACGACTCTCCAATTCATATCTCGAGATATGAATTGGAGAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029049
PTCHD3 MISSION shRNA Lentiviral Transduction Particles
patched domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2088s21c1
Sequence:CCGGCTAATGACAAGAATACCTTTACTCGAGTAAAGGTATTCTTGTCATTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029049.1-2986s21c1
Sequence:CCGGGAGGGTAATGTAGGATATAAACTCGAGTTTATATCCTACATTACCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2282s21c1
Sequence:CCGGGAAGTTCCCTTAATGGTATATCTCGAGATATACCATTAAGGGAACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-2065s21c1
Sequence:CCGGCATGAATAGCAGCGGAAATAACTCGAGTTATTTCCGCTGCTATTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029049.1-1382s21c1
Sequence:CCGGGAACGACTCTCCAATTCATATCTCGAGATATGAATTGGAGAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034842
PTCHD3 MISSION shRNA Bacterial Glycerol Stock
patched domain containing 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2168s1c1
Sequence:CCGGGCCAAGATCCTAATGAGAAGACTCGAGTCTTCTCATTAGGATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1762s1c1
Sequence:CCGGCCAGATGAACATGGAACTGATCTCGAGATCAGTTCCATGTTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1681s1c1
Sequence:CCGGGTCTGCCTATGCTGGTTGAAACTCGAGTTTCAACCAGCATAGGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1206s1c1
Sequence:CCGGCCTGGCATACATTCTCATCATCTCGAGATGATGAGAATGTATGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2035s1c1
Sequence:CCGGGTTGACTACTGGGATAAAGATCTCGAGATCTTTATCCCAGTAGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1290s1c1
Sequence:CCGGCTTTGGAGTGATTTCTGCTTTCTCGAGAAAGCAGAAATCACTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1080s1c1
Sequence:CCGGGCTCGATCAATTTACCAACATCTCGAGATGTTGGTAAATTGATCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1441s1c1
Sequence:CCGGCATAAGACCAACCTTGCAGATCTCGAGATCTGCAAGGTTGGTCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-655s1c1
Sequence:CCGGGAAGCCAATTTCGTCTCGCTTCTCGAGAAGCGAGACGAAATTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-660s1c1
Sequence:CCGGCAATTTCGTCTCGCTTCTGGTCTCGAGACCAGAAGCGAGACGAAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1994s1c1
Sequence:CCGGCAGATTATGGTCCCAGGGTTACTCGAGTAACCCTGGGACCATAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-710s1c1
Sequence:CCGGCAGCTACCTTTGCAGAAGTCACTCGAGTGACTTCTGCAAAGGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034842
PTCHD3 MISSION shRNA shRNA Plasmid DNA
patched domain containing 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2168s1c1
Sequence:CCGGGCCAAGATCCTAATGAGAAGACTCGAGTCTTCTCATTAGGATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1762s1c1
Sequence:CCGGCCAGATGAACATGGAACTGATCTCGAGATCAGTTCCATGTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1681s1c1
Sequence:CCGGGTCTGCCTATGCTGGTTGAAACTCGAGTTTCAACCAGCATAGGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1206s1c1
Sequence:CCGGCCTGGCATACATTCTCATCATCTCGAGATGATGAGAATGTATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2035s1c1
Sequence:CCGGGTTGACTACTGGGATAAAGATCTCGAGATCTTTATCCCAGTAGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1290s1c1
Sequence:CCGGCTTTGGAGTGATTTCTGCTTTCTCGAGAAAGCAGAAATCACTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1080s1c1
Sequence:CCGGGCTCGATCAATTTACCAACATCTCGAGATGTTGGTAAATTGATCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1441s1c1
Sequence:CCGGCATAAGACCAACCTTGCAGATCTCGAGATCTGCAAGGTTGGTCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-655s1c1
Sequence:CCGGGAAGCCAATTTCGTCTCGCTTCTCGAGAAGCGAGACGAAATTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-660s1c1
Sequence:CCGGCAATTTCGTCTCGCTTCTGGTCTCGAGACCAGAAGCGAGACGAAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1994s1c1
Sequence:CCGGCAGATTATGGTCCCAGGGTTACTCGAGTAACCCTGGGACCATAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-710s1c1
Sequence:CCGGCAGCTACCTTTGCAGAAGTCACTCGAGTGACTTCTGCAAAGGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034842
PTCHD3 MISSION shRNA Lentiviral Transduction Particles
patched domain containing 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2168s1c1
Sequence:CCGGGCCAAGATCCTAATGAGAAGACTCGAGTCTTCTCATTAGGATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1762s1c1
Sequence:CCGGCCAGATGAACATGGAACTGATCTCGAGATCAGTTCCATGTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1681s1c1
Sequence:CCGGGTCTGCCTATGCTGGTTGAAACTCGAGTTTCAACCAGCATAGGCAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1206s1c1
Sequence:CCGGCCTGGCATACATTCTCATCATCTCGAGATGATGAGAATGTATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-2035s1c1
Sequence:CCGGGTTGACTACTGGGATAAAGATCTCGAGATCTTTATCCCAGTAGTCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1290s1c1
Sequence:CCGGCTTTGGAGTGATTTCTGCTTTCTCGAGAAAGCAGAAATCACTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1080s1c1
Sequence:CCGGGCTCGATCAATTTACCAACATCTCGAGATGTTGGTAAATTGATCGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1441s1c1
Sequence:CCGGCATAAGACCAACCTTGCAGATCTCGAGATCTGCAAGGTTGGTCTTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-655s1c1
Sequence:CCGGGAAGCCAATTTCGTCTCGCTTCTCGAGAAGCGAGACGAAATTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-660s1c1
Sequence:CCGGCAATTTCGTCTCGCTTCTGGTCTCGAGACCAGAAGCGAGACGAAATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-1994s1c1
Sequence:CCGGCAGATTATGGTCCCAGGGTTACTCGAGTAACCCTGGGACCATAATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034842.1-710s1c1
Sequence:CCGGCAGCTACCTTTGCAGAAGTCACTCGAGTGACTTCTGCAAAGGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)