EMAIL THIS PAGE TO A FRIEND

PTDSS1

phosphatidylserine synthase 1

153 Gene Product Result for
Synonyms: PSS1 PSSA
UniProtKB ID: P48651
Gene ID:
Human(9791) Summary: Phosphatidylserine (PS) accounts for 5 to 10% of cell membrane phospholipids. In addition to its role as a structural component, PS is involved in cell signaling, blood coagulation, and apoptosis. PS is synthesized by a calcium-dependent base-exchange reaction catalyzed by PS synthases (EC 2.7.8.8), like PTDSS1, that exchange L-serine for the polar head group of phosphatidylcholine (PC) or phosphatidylethanolamine (PE) (Sturbois-Balcerzak et al., 2001 [PubMed 11084049]
Mouse(19210) phosphatidylserine synthase 1
Rat(314553) phosphatidylserine synthase 1
Zebrafish(393931) phosphatidylserine synthase 1
dog(611965) phosphatidylserine synthase 1
domestic cat(101091087) phosphatidylserine synthase 1
chicken(428374) phosphatidylserine synthase 1
cow(509819) phosphatidylserine synthase 1
sheep(101108059) phosphatidylserine synthase 1
domestic guinea pig(100731351) phosphatidylserine synthase 1
naked mole-rat(101708774) phosphatidylserine synthase 1
Domestic Rabbit(100355276) phosphatidylserine synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014754 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014754 Rosetta Predictions human pricing
NM_001012113 Rosetta Predictions rat pricing
XM_576244 Rosetta Predictions rat pricing
NM_008959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133344 predicted 468
2 SASI_Hs01_00133345 predicted 1282
3 SASI_Hs01_00133346 predicted 1209
4 SASI_Hs02_00346222 predicted 462
5 SASI_Hs01_00133348 predicted 571
6 SASI_Hs01_00133350 predicted 1033
7 SASI_Hs01_00133351 predicted 251
8 SASI_Hs01_00133353 predicted 1528
9 SASI_Hs02_00346223 predicted 1233
10 SASI_Hs02_00346224 predicted 624
11 SASI_Hs01_00133347 predicted 1253
12 SASI_Hs01_00133349 predicted 555
13 SASI_Hs01_00133352 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040935 predicted 1340
2 SASI_Rn01_00040937 predicted 574
3 SASI_Rn01_00040938 predicted 1216
4 SASI_Rn02_00200263 predicted 1006
5 SASI_Rn02_00200264 predicted 596
6 SASI_Rn01_00040939 predicted 1052
7 SASI_Rn01_00040940 predicted 587
8 SASI_Rn01_00040941 predicted 628
9 SASI_Rn01_00040943 predicted 1321
10 SASI_Rn01_00040944 predicted 1280
11 SASI_Rn01_00040936 predicted 643
12 SASI_Rn01_00040942 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142231 predicted 847
2 SASI_Rn01_00142232 predicted 783
3 SASI_Rn01_00142233 predicted 1420
4 SASI_Rn01_00142234 predicted 640
5 SASI_Rn01_00142235 predicted 1206
6 SASI_Rn01_00142236 predicted 1265
7 SASI_Rn01_00142237 predicted 793
8 SASI_Rn01_00142238 predicted 835
9 SASI_Rn01_00142239 predicted 449
10 SASI_Rn01_00142240 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315031 predicted 1818
2 SASI_Mm01_00056106 predicted 1538
3 SASI_Mm01_00056107 predicted 1768
4 SASI_Mm01_00056110 predicted 2162
5 SASI_Mm01_00056111 predicted 1821
6 SASI_Mm02_00315032 predicted 2044
7 SASI_Mm01_00056112 predicted 1494
8 SASI_Mm01_00056113 predicted 1579
9 SASI_Mm01_00056114 predicted 1158
10 SASI_Mm01_00056115 predicted 1201
11 SASI_Mm01_00056108 predicted 2101
12 SASI_Mm01_00056109 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008959
VALIDATED
PTDSS1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylserine synthase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008959.2-2743s1c1
Sequence:CCGGCGGCTTCAGATTAGAACTGTTCTCGAGAACAGTTCTAATCTGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1217s1c1
Sequence:CCGGGCCTTGTTGATCCGTAGTTATCTCGAGATAACTACGGATCAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1039s1c1
Sequence:CCGGCCTGAACTTCGAGCAGGTTAACTCGAGTTAACCTGCTCGAAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1158s1c1
Sequence:CCGGGAATCGTTAGTCACTTTGATACTCGAGTATCAAAGTGACTAACGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-2022s1c1
Sequence:CCGGGCAACCACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1240s21c1
Sequence:CCGGCTTTGCTGGACAATCAGTATCCTCGAGGATACTGATTGTCCAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1767s21c1
Sequence:CCGGGGAAGCTATTGTTTGCATAAACTCGAGTTTATGCAAACAATAGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1808s21c1
Sequence:CCGGCTAAGACCCAGATACTCTATGCTCGAGCATAGAGTATCTGGGTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-917s21c1
Sequence:CCGGTTCTCATCATCAGCGTGTTAGCTCGAGCTAACACGCTGATGATGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-2094s21c1
Sequence:CCGGGAAATGAAGGAAGCTAGTTAACTCGAGTTAACTAGCTTCCTTCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008959
VALIDATED
PTDSS1 MISSION shRNA shRNA Plasmid DNA
phosphatidylserine synthase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008959.2-2743s1c1
Sequence:CCGGCGGCTTCAGATTAGAACTGTTCTCGAGAACAGTTCTAATCTGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1217s1c1
Sequence:CCGGGCCTTGTTGATCCGTAGTTATCTCGAGATAACTACGGATCAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1039s1c1
Sequence:CCGGCCTGAACTTCGAGCAGGTTAACTCGAGTTAACCTGCTCGAAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1158s1c1
Sequence:CCGGGAATCGTTAGTCACTTTGATACTCGAGTATCAAAGTGACTAACGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-2022s1c1
Sequence:CCGGGCAACCACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1240s21c1
Sequence:CCGGCTTTGCTGGACAATCAGTATCCTCGAGGATACTGATTGTCCAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1767s21c1
Sequence:CCGGGGAAGCTATTGTTTGCATAAACTCGAGTTTATGCAAACAATAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1808s21c1
Sequence:CCGGCTAAGACCCAGATACTCTATGCTCGAGCATAGAGTATCTGGGTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-917s21c1
Sequence:CCGGTTCTCATCATCAGCGTGTTAGCTCGAGCTAACACGCTGATGATGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-2094s21c1
Sequence:CCGGGAAATGAAGGAAGCTAGTTAACTCGAGTTAACTAGCTTCCTTCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008959
VALIDATED
PTDSS1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylserine synthase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008959.2-2743s1c1
Sequence:CCGGCGGCTTCAGATTAGAACTGTTCTCGAGAACAGTTCTAATCTGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1217s1c1
Sequence:CCGGGCCTTGTTGATCCGTAGTTATCTCGAGATAACTACGGATCAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1039s1c1
Sequence:CCGGCCTGAACTTCGAGCAGGTTAACTCGAGTTAACCTGCTCGAAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-1158s1c1
Sequence:CCGGGAATCGTTAGTCACTTTGATACTCGAGTATCAAAGTGACTAACGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008959.2-2022s1c1
Sequence:CCGGGCAACCACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1240s21c1
Sequence:CCGGCTTTGCTGGACAATCAGTATCCTCGAGGATACTGATTGTCCAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1767s21c1
Sequence:CCGGGGAAGCTATTGTTTGCATAAACTCGAGTTTATGCAAACAATAGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-1808s21c1
Sequence:CCGGCTAAGACCCAGATACTCTATGCTCGAGCATAGAGTATCTGGGTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-917s21c1
Sequence:CCGGTTCTCATCATCAGCGTGTTAGCTCGAGCTAACACGCTGATGATGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008959.3-2094s21c1
Sequence:CCGGGAAATGAAGGAAGCTAGTTAACTCGAGTTAACTAGCTTCCTTCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014754
VALIDATED
PTDSS1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylserine synthase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-471s1c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-498s1c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-916s1c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014754.1-999s1c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014754.1-1445s1c1
Sequence:CCGGGCAACAACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-916s21c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-471s21c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-498s21c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-999s21c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014754
VALIDATED
PTDSS1 MISSION shRNA shRNA Plasmid DNA
phosphatidylserine synthase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-471s1c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-498s1c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-916s1c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014754.1-999s1c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014754.1-1445s1c1
Sequence:CCGGGCAACAACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-916s21c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-471s21c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-498s21c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-999s21c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014754
VALIDATED
PTDSS1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylserine synthase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-471s1c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-498s1c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_014754.1-916s1c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014754.1-999s1c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014754.1-1445s1c1
Sequence:CCGGGCAACAACGAAAGCCATTCTTCTCGAGAAGAATGGCTTTCGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-916s21c1
Sequence:CCGGTGGACCTATGTTCGATGGTTTCTCGAGAAACCATCGAACATAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-471s21c1
Sequence:CCGGCGAGCAGGTTAAATCTCTAATCTCGAGATTAGAGATTTAACCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-498s21c1
Sequence:CCGGGCTAGATCCAAATCTTCGATACTCGAGTATCGAAGATTTGGATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014754.1-999s21c1
Sequence:CCGGGACTGAGTTGAATACCTTCTTCTCGAGAAGAAGGTATTCAACTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)