EMAIL THIS PAGE TO A FRIEND

PTEN

phosphatase and tensin homolog

292 Gene Product Result for
Synonyms: 10q23del BZS CWS1 DEC GLM2 MHAM MMAC1 PTEN1 TEP1
UniProtKB ID: P60484, B2R904, O00633, O02679, Q6ICT7
Gene ID:
Human(5728) Summary: This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(19211) phosphatase and tensin homolog
Rat(50557) phosphatase and tensin homolog
fruit fly(43991) CG5671 gene product from transcript CG5671-RB
domestic cat(101091813) phosphatase and tensin homolog
dog(403832) phosphatase and tensin homolog
chicken(423675) phosphatase and tensin homolog
cow(540786) phosphatase and tensin homolog
sheep(101119351) phosphatase and tensin homolog
domestic guinea pig(100723659) phosphatase and tensin homolog
naked mole-rat(101714930) phosphatase and tensin homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500084 Anti-Cleaved PTEN antibody, Rabbit monoclonal clone SP227, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4504520 Anti-phospho-PTEN (pSer370) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300044 Anti-phospho-PTEN (pSer380/pThr382/pThr383) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504521 Anti-phospho-PTEN (pSer380/Thr382/383) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4503980 Anti-phospho-PTEN (pSer385) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA pricing
SAB4300337 Anti-PTEN (Ab-370) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300336 Anti-PTEN (Ab-380/382/383) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB2501614 Anti-PTEN antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, human, mouse
ELISA, western blot pricing
SAB1406331 Anti-PTEN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA031335 Anti-PTEN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
P7482 Anti-PTEN antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat
microarray, western blot pricing
SAB3500337 Anti-PTEN antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunoprecipitation (IP), western blot pricing
SAB4502473 Anti-PTEN antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4502474 Anti-PTEN antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4502475 Anti-PTEN antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4502476 Anti-PTEN antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB5500168 Anti-PTEN antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP170, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB5500169 Anti-PTEN antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP218, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
WH0005728M1 Monoclonal Anti-PTEN antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
P3487 Monoclonal Anti-PTEN antibody produced in mouse ~1 mg/mL, purified immunoglobulin, clone PTN-18, buffered aqueous solution rat, mouse, human
ELISA, immunocytochemistry, microarray, western blot pricing
SAB1404272 Monoclonal Anti-PTEN antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4100580 Monoclonal Anti-PTEN antibody produced in mouse clone PTEN-A552, culture supernatant human
western blot pricing
PLA0133 Rabbit anti-PTEN Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, rhesus monkey, turkey, primate, bovine, human, rabbit, horse, guinea pig, dog, mouse, chicken
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000314 Rosetta Predictions human pricing
NM_031606 Rosetta Predictions rat pricing
NM_008960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196478 predicted 1420
2 SASI_Hs01_00196479 predicted 1573
3 SASI_Hs01_00196480 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101624 predicted 379
2 SASI_Rn01_00101625 predicted 660
3 SASI_Rn01_00101626 predicted 494
4 SASI_Rn01_00101627 predicted 385
5 SASI_Rn01_00101628 predicted 340
6 SASI_Rn01_00101629 predicted 573
7 SASI_Rn02_00264886 predicted 655
8 SASI_Rn01_00101630 predicted 600
9 SASI_Rn01_00101633 predicted 340
10 SASI_Rn02_00264887 predicted 584
11 SASI_Rn01_00101631 predicted 444
12 SASI_Rn01_00101632 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315033 predicted 1515
2 SASI_Mm01_00152659 predicted 1252
3 SASI_Mm01_00152660 predicted 1303
4 SASI_Mm01_00152661 predicted 1215
5 SASI_Mm02_00315034 predicted 879
6 SASI_Mm01_00152662 predicted 1009
7 SASI_Mm01_00152663 predicted 1469
8 SASI_Mm01_00152664 predicted 995
9 SASI_Mm01_00152665 predicted 1452
10 SASI_Mm01_00152666 predicted 1753
11 SASI_Mm01_00152667 predicted 939
12 SASI_Mm01_00152668 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000314
VALIDATED
PTEN MISSION shRNA Bacterial Glycerol Stock
phosphatase and tensin homolog
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000314.x-1326s1c1
Sequence:CCGGCTAGAACTTATCAAACCCTTTCTCGAGAAAGGGTTTGATAAGTTCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1548s1c1
Sequence:CCGGAGGCGCTATGTGTATTATTATCTCGAGATAATAATACACATAGCGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000314.x-3001s1c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1956s1c1
Sequence:CCGGCGTGCAGATAATGACAAGGAACTCGAGTTCCTTGTCATTATCTGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1253s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1472s21c1
Sequence:CCGGGGCACAAGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCTTGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1095s21c1
Sequence:CCGGGACTTAGACTTGACCTATATTCTCGAGAATATAGGTCAAGTCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1417s21c1
Sequence:CCGGGACGAACTGGTGTAATGATATCTCGAGATATCATTACACCAGTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-2079s21c1
Sequence:CCGGACAGTAGAGGAGCCGTCAAATCTCGAGATTTGACGGCTCCTCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-5217s21c1
Sequence:GTACCGGGGGCTTTAACTGTAGTATTTGCTCGAGCAAATACTACAGTTAAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-4992s21c1
Sequence:CCGGTGCTGTGGCACAGGTTATAAACTCGAGTTTATAACCTGTGCCACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-4405s21c1
Sequence:CCGGATTTCGGGCACCGCATATTAACTCGAGTTAATATGCGGTGCCCGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-2996s21c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-2798s21c1
Sequence:CCGGTATACCATCTCCAGCTATTTACTCGAGTAAATAGCTGGAGATGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000314
VALIDATED
PTEN MISSION shRNA shRNA Plasmid DNA
phosphatase and tensin homolog
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000314.x-1326s1c1
Sequence:CCGGCTAGAACTTATCAAACCCTTTCTCGAGAAAGGGTTTGATAAGTTCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1548s1c1
Sequence:CCGGAGGCGCTATGTGTATTATTATCTCGAGATAATAATACACATAGCGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000314.x-3001s1c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1956s1c1
Sequence:CCGGCGTGCAGATAATGACAAGGAACTCGAGTTCCTTGTCATTATCTGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1253s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1472s21c1
Sequence:CCGGGGCACAAGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCTTGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1095s21c1
Sequence:CCGGGACTTAGACTTGACCTATATTCTCGAGAATATAGGTCAAGTCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1417s21c1
Sequence:CCGGGACGAACTGGTGTAATGATATCTCGAGATATCATTACACCAGTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-2079s21c1
Sequence:CCGGACAGTAGAGGAGCCGTCAAATCTCGAGATTTGACGGCTCCTCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-5217s21c1
Sequence:GTACCGGGGGCTTTAACTGTAGTATTTGCTCGAGCAAATACTACAGTTAAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-4992s21c1
Sequence:CCGGTGCTGTGGCACAGGTTATAAACTCGAGTTTATAACCTGTGCCACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-4405s21c1
Sequence:CCGGATTTCGGGCACCGCATATTAACTCGAGTTAATATGCGGTGCCCGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-2996s21c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-2798s21c1
Sequence:CCGGTATACCATCTCCAGCTATTTACTCGAGTAAATAGCTGGAGATGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000314
VALIDATED
PTEN MISSION shRNA Lentiviral Transduction Particles
phosphatase and tensin homolog
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000314.x-1326s1c1
Sequence:CCGGCTAGAACTTATCAAACCCTTTCTCGAGAAAGGGTTTGATAAGTTCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1548s1c1
Sequence:CCGGAGGCGCTATGTGTATTATTATCTCGAGATAATAATACACATAGCGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000314.x-3001s1c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A-431
TRC Version: 1 Clone ID:NM_000314.x-1956s1c1
Sequence:CCGGCGTGCAGATAATGACAAGGAACTCGAGTTCCTTGTCATTATCTGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1253s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1472s21c1
Sequence:CCGGGGCACAAGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCTTGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1095s21c1
Sequence:CCGGGACTTAGACTTGACCTATATTCTCGAGAATATAGGTCAAGTCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-1417s21c1
Sequence:CCGGGACGAACTGGTGTAATGATATCTCGAGATATCATTACACCAGTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000314.4-2079s21c1
Sequence:CCGGACAGTAGAGGAGCCGTCAAATCTCGAGATTTGACGGCTCCTCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-5217s21c1
Sequence:GTACCGGGGGCTTTAACTGTAGTATTTGCTCGAGCAAATACTACAGTTAAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-4992s21c1
Sequence:CCGGTGCTGTGGCACAGGTTATAAACTCGAGTTTATAACCTGTGCCACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-4405s21c1
Sequence:CCGGATTTCGGGCACCGCATATTAACTCGAGTTAATATGCGGTGCCCGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000314.4-2996s21c1
Sequence:CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000314.4-2798s21c1
Sequence:CCGGTATACCATCTCCAGCTATTTACTCGAGTAAATAGCTGGAGATGGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008960
VALIDATED
PTEN MISSION shRNA Bacterial Glycerol Stock
phosphatase and tensin homolog
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008960.1-1873s1c1
Sequence:CCGGGCAGATAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1601s1c1
Sequence:CCGGGCCAGCTAAAGGTGAAGATATCTCGAGATATCTTCACCTTTAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1947s1c1
Sequence:CCGGCAACCGATACTTCTCTCCAAACTCGAGTTTGGAGAGAAGTATCGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1239s1c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1159s21c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-931s21c1
Sequence:CCGGCGACTTAGACTTGACCTATATCTCGAGATATAGGTCAAGTCTAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-2512s21c1
Sequence:CCGGTTGTGGCAACAGATAAGTTTGCTCGAGCAAACTTATCTGTTGCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008960.2-1012s21c1
Sequence:CCGGCAATATTGATGATGTAGTAAGCTCGAGCTTACTACATCATCAATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1090s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008960
VALIDATED
PTEN MISSION shRNA shRNA Plasmid DNA
phosphatase and tensin homolog
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008960.1-1873s1c1
Sequence:CCGGGCAGATAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1601s1c1
Sequence:CCGGGCCAGCTAAAGGTGAAGATATCTCGAGATATCTTCACCTTTAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1947s1c1
Sequence:CCGGCAACCGATACTTCTCTCCAAACTCGAGTTTGGAGAGAAGTATCGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1239s1c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1159s21c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-931s21c1
Sequence:CCGGCGACTTAGACTTGACCTATATCTCGAGATATAGGTCAAGTCTAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-2512s21c1
Sequence:CCGGTTGTGGCAACAGATAAGTTTGCTCGAGCAAACTTATCTGTTGCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008960.2-1012s21c1
Sequence:CCGGCAATATTGATGATGTAGTAAGCTCGAGCTTACTACATCATCAATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1090s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008960
VALIDATED
PTEN MISSION shRNA Lentiviral Transduction Particles
phosphatase and tensin homolog
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008960.1-1873s1c1
Sequence:CCGGGCAGATAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1601s1c1
Sequence:CCGGGCCAGCTAAAGGTGAAGATATCTCGAGATATCTTCACCTTTAGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1947s1c1
Sequence:CCGGCAACCGATACTTCTCTCCAAACTCGAGTTTGGAGAGAAGTATCGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008960.1-1239s1c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1159s21c1
Sequence:CCGGGCTAGAACTTATCAAACCCTTCTCGAGAAGGGTTTGATAAGTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-931s21c1
Sequence:CCGGCGACTTAGACTTGACCTATATCTCGAGATATAGGTCAAGTCTAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-2512s21c1
Sequence:CCGGTTGTGGCAACAGATAAGTTTGCTCGAGCAAACTTATCTGTTGCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008960.2-1012s21c1
Sequence:CCGGCAATATTGATGATGTAGTAAGCTCGAGCTTACTACATCATCAATATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008960.2-1090s21c1
Sequence:CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)