EMAIL THIS PAGE TO A FRIEND

PTGDR

prostaglandin D2 receptor (DP)

134 Gene Product Result for
Synonyms: AS1 ASRT1 DP DP1 PTGDR1
UniProtKB ID: Q13258, Q13250, Q13251, Q1ZZ52
Gene ID:
Human(5729) Summary: The protein encoded by this gene is a G-protein-coupled receptor. It has been shown to function as a prostanoid DP receptor. The activity of this receptor is mainly mediated by G-S proteins that stimulate adenylate cyclase resulting in an elevation of intracellular cAMP and Ca2+. Knockout studies in mice suggest that the ligand of this receptor, prostaglandin D2 (PGD2), functions as a mast cell-derived mediator to trigger asthmatic responses. [provided by RefSeq, Jul 2008]
Mouse(19214) prostaglandin D receptor
Rat(498475) prostaglandin D2 receptor-like
domestic cat(101098059) prostaglandin D2 receptor (DP)
dog(610845) prostaglandin D2 receptor (DP)
cow(515331) prostaglandin D2 receptor (DP)
naked mole-rat(101710975) prostaglandin D2 receptor (DP)
domestic guinea pig(100721994) prostaglandin D2 receptor (DP)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
B9305 BW 245C ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000953 Rosetta Predictions human pricing
XM_573732 Rosetta Predictions rat pricing
NM_008962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107280 predicted 900
2 SASI_Hs01_00107281 predicted 910
3 SASI_Hs01_00107282 predicted 586
4 SASI_Hs01_00107284 predicted 963
5 SASI_Hs01_00107285 predicted 933
6 SASI_Hs01_00107286 predicted 390
7 SASI_Hs01_00107287 predicted 921
8 SASI_Hs01_00107288 predicted 593
9 SASI_Hs02_00303566 predicted 581
10 SASI_Hs01_00107289 predicted 949
11 SASI_Hs01_00107283 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400690 predicted 873
2 SASI_Rn02_00400691 predicted 343
3 SASI_Rn02_00400692 predicted 334
4 SASI_Rn02_00400693 predicted 977
5 SASI_Rn02_00400694 predicted 475
6 SASI_Rn02_00400695 predicted 691
7 SASI_Rn02_00400696 predicted 1185
8 SASI_Rn02_00400697 predicted 727
9 SASI_Rn02_00400698 predicted 388
10 SASI_Rn02_00400699 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053716 predicted 1102
2 SASI_Mm01_00053717 predicted 410
3 SASI_Mm01_00053718 predicted 848
4 SASI_Mm01_00053719 predicted 469
5 SASI_Mm01_00053720 predicted 1161
6 SASI_Mm02_00315038 predicted 1198
7 SASI_Mm01_00053721 predicted 255
8 SASI_Mm01_00053722 predicted 1081
9 SASI_Mm01_00053724 predicted 311
10 SASI_Mm01_00053725 predicted 774
11 SASI_Mm01_00053723 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000953
PTGDR MISSION shRNA Bacterial Glycerol Stock
prostaglandin D2 receptor (DP)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1646s21c1
Sequence:CCGGTTGCCGATGTTTAGTTCATTTCTCGAGAAATGAACTAAACATCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1548s21c1
Sequence:CCGGACACCACTGTTTACGATTATACTCGAGTATAATCGTAAACAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000953.2-930s21c1
Sequence:CCGGGTGTTCTCTGCCCGTAATTTACTCGAGTAAATTACGGGCAGAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000953.2-2179s1c1
Sequence:CCGGGCTACCTATTACAGCCGTATTCTCGAGAATACGGCTGTAATAGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1028s1c1
Sequence:CCGGTGCGATTTCTATCTGTGATTTCTCGAGAAATCACAGATAGAAATCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-427s1c1
Sequence:CCGGGCCTTCTTCATGTCCTTCTTTCTCGAGAAAGAAGGACATGAAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-939s1c1
Sequence:CCGGGCCCGTAATTTATCGCGCTTACTCGAGTAAGCGCGATAAATTACGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1143s1c1
Sequence:CCGGCCGGTGCAGCAATTCCACTAACTCGAGTTAGTGGAATTGCTGCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000953
PTGDR MISSION shRNA shRNA Plasmid DNA
prostaglandin D2 receptor (DP)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1646s21c1
Sequence:CCGGTTGCCGATGTTTAGTTCATTTCTCGAGAAATGAACTAAACATCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1548s21c1
Sequence:CCGGACACCACTGTTTACGATTATACTCGAGTATAATCGTAAACAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000953.2-930s21c1
Sequence:CCGGGTGTTCTCTGCCCGTAATTTACTCGAGTAAATTACGGGCAGAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000953.2-2179s1c1
Sequence:CCGGGCTACCTATTACAGCCGTATTCTCGAGAATACGGCTGTAATAGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1028s1c1
Sequence:CCGGTGCGATTTCTATCTGTGATTTCTCGAGAAATCACAGATAGAAATCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-427s1c1
Sequence:CCGGGCCTTCTTCATGTCCTTCTTTCTCGAGAAAGAAGGACATGAAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-939s1c1
Sequence:CCGGGCCCGTAATTTATCGCGCTTACTCGAGTAAGCGCGATAAATTACGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1143s1c1
Sequence:CCGGCCGGTGCAGCAATTCCACTAACTCGAGTTAGTGGAATTGCTGCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000953
PTGDR MISSION shRNA Lentiviral Transduction Particles
prostaglandin D2 receptor (DP)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1646s21c1
Sequence:CCGGTTGCCGATGTTTAGTTCATTTCTCGAGAAATGAACTAAACATCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000953.2-1548s21c1
Sequence:CCGGACACCACTGTTTACGATTATACTCGAGTATAATCGTAAACAGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000953.2-930s21c1
Sequence:CCGGGTGTTCTCTGCCCGTAATTTACTCGAGTAAATTACGGGCAGAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000953.2-2179s1c1
Sequence:CCGGGCTACCTATTACAGCCGTATTCTCGAGAATACGGCTGTAATAGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1028s1c1
Sequence:CCGGTGCGATTTCTATCTGTGATTTCTCGAGAAATCACAGATAGAAATCGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-427s1c1
Sequence:CCGGGCCTTCTTCATGTCCTTCTTTCTCGAGAAAGAAGGACATGAAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-939s1c1
Sequence:CCGGGCCCGTAATTTATCGCGCTTACTCGAGTAAGCGCGATAAATTACGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000953.2-1143s1c1
Sequence:CCGGCCGGTGCAGCAATTCCACTAACTCGAGTTAGTGGAATTGCTGCACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008962
PTGDR MISSION shRNA Bacterial Glycerol Stock
prostaglandin D2 receptor (DP)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-985s1c1
Sequence:CCGGGCCTTTAAACTTGAGAACAAACTCGAGTTTGTTCTCAAGTTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-957s1c1
Sequence:CCGGGCCTTTAATTTATCGTGCGTACTCGAGTACGCACGATAAATTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-1166s1c1
Sequence:CCGGCCCAGCAAAGTAACGTGGAATCTCGAGATTCCACGTTACTTTGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-422s1c1
Sequence:CCGGGCAATCAGTTATGCGAAACGTCTCGAGACGTTTCGCATAACTGATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008962
PTGDR MISSION shRNA shRNA Plasmid DNA
prostaglandin D2 receptor (DP)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-985s1c1
Sequence:CCGGGCCTTTAAACTTGAGAACAAACTCGAGTTTGTTCTCAAGTTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-957s1c1
Sequence:CCGGGCCTTTAATTTATCGTGCGTACTCGAGTACGCACGATAAATTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-1166s1c1
Sequence:CCGGCCCAGCAAAGTAACGTGGAATCTCGAGATTCCACGTTACTTTGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-422s1c1
Sequence:CCGGGCAATCAGTTATGCGAAACGTCTCGAGACGTTTCGCATAACTGATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008962
PTGDR MISSION shRNA Lentiviral Transduction Particles
prostaglandin D2 receptor (DP)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-985s1c1
Sequence:CCGGGCCTTTAAACTTGAGAACAAACTCGAGTTTGTTCTCAAGTTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-957s1c1
Sequence:CCGGGCCTTTAATTTATCGTGCGTACTCGAGTACGCACGATAAATTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-1166s1c1
Sequence:CCGGCCCAGCAAAGTAACGTGGAATCTCGAGATTCCACGTTACTTTGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008962.2-422s1c1
Sequence:CCGGGCAATCAGTTATGCGAAACGTCTCGAGACGTTTCGCATAACTGATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)