EMAIL THIS PAGE TO A FRIEND

PTGDS

prostaglandin D2 synthase 21kDa (brain)

104 Gene Product Result for
Synonyms: L-PGDS LPGDS PDS PGD2 PGDS PGDS2
Gene ID:
Human(5730) Summary: The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]
Mouse(19215) prostaglandin D2 synthase (brain)
Rat(25526) prostaglandin D2 synthase (brain)
domestic guinea pig(100732586) prostaglandin D2 synthase 21kDa (brain)
naked mole-rat(101699559) prostaglandin D2 synthase 21kDa (brain)
cow(286858) prostaglandin D2 synthase 21kDa (brain)
sheep(443192) prostaglandin D2 synthase 21kDa (brain)
chicken(374110) prostaglandin D2 synthase 21kDa (brain)
Horse(100067921) prostaglandin D2 synthase 21kDa (brain)
domestic cat(493852) prostaglandin D2 synthase 21kDa (brain)
dog(403740) prostaglandin D2 synthase 21kDa (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066771 MISSION® esiRNA esiRNA targeting mouse Ptgds (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000954 Rosetta Predictions human pricing
NM_013015 Rosetta Predictions rat pricing
NM_008963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085043 predicted 247
2 SASI_Hs01_00085044 predicted 583
3 SASI_Hs01_00085045 predicted 338
4 SASI_Hs01_00085046 predicted 514
5 SASI_Hs01_00085047 predicted 416
6 SASI_Hs01_00085048 predicted 586
7 SASI_Hs01_00085049 predicted 585
8 SASI_Hs01_00085050 predicted 249
9 SASI_Hs02_00303567 predicted 306
10 SASI_Hs01_00085051 predicted 237
11 SASI_Hs01_00085052 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069147 predicted 388
2 SASI_Rn01_00069148 predicted 227
3 SASI_Rn01_00069149 predicted 212
4 SASI_Rn01_00069150 predicted 297
5 SASI_Rn01_00069151 predicted 267
6 SASI_Rn02_00260677 predicted 292
7 SASI_Rn01_00069153 predicted 403
8 SASI_Rn02_00260678 predicted 210
9 SASI_Rn01_00069154 predicted 469
10 SASI_Rn02_00260679 predicted 287
11 SASI_Rn01_00069152 predicted 268
12 SASI_Rn01_00069155 predicted 436
13 SASI_Rn01_00069156 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116072 predicted 239
2 SASI_Mm01_00116073 predicted 511
3 SASI_Mm01_00116074 predicted 340
4 SASI_Mm01_00116075 predicted 249
5 SASI_Mm01_00116076 predicted 236
6 SASI_Mm01_00116077 predicted 340
7 SASI_Mm01_00116078 predicted 286
8 SASI_Mm01_00116079 predicted 248
9 SASI_Mm01_00116080 predicted 428
10 SASI_Mm01_00116081 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000954
PTGDS MISSION shRNA Bacterial Glycerol Stock
prostaglandin D2 synthase 21kDa (brain)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-304s21c1
Sequence:CCGGCTCAACCTGACCTCCACCTTCCTCGAGGAAGGTGGAGGTCAGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-337s21c1
Sequence:CCGGCAGTGTGAGACCCGAACCATGCTCGAGCATGGTTCGGGTCTCACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-625s1c1
Sequence:CCGGGATAAGTGCATGACGGAACAACTCGAGTTGTTCCGTCATGCACTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-256s1c1
Sequence:CCGGGCGTTGTCCATGTGCAAGTCTCTCGAGAGACTTGCACATGGACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-591s1c1
Sequence:CCGGCACAGAGGATACCATTGTCTTCTCGAGAAGACAATGGTATCCTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-554s21c1
Sequence:CCGGAGGAGAAATTCACCGCCTTCTCTCGAGAGAAGGCGGTGAATTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-170s21c1
Sequence:CCGGCCAACTTCCAGCAGGACAAGTCTCGAGACTTGTCCTGCTGGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-540s1c1
Sequence:CCGGCAGGGCTGAGTTAAAGGAGAACTCGAGTTCTCCTTTAACTCAGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-417s21c1
Sequence:CCGGCACCTACTCCGTGTCAGTGGTCTCGAGACCACTGACACGGAGTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-440s21c1
Sequence:CCGGAGACCGACTACGACCAGTACGCTCGAGCGTACTGGTCGTAGTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000954
PTGDS MISSION shRNA shRNA Plasmid DNA
prostaglandin D2 synthase 21kDa (brain)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-304s21c1
Sequence:CCGGCTCAACCTGACCTCCACCTTCCTCGAGGAAGGTGGAGGTCAGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-337s21c1
Sequence:CCGGCAGTGTGAGACCCGAACCATGCTCGAGCATGGTTCGGGTCTCACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-625s1c1
Sequence:CCGGGATAAGTGCATGACGGAACAACTCGAGTTGTTCCGTCATGCACTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-256s1c1
Sequence:CCGGGCGTTGTCCATGTGCAAGTCTCTCGAGAGACTTGCACATGGACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-591s1c1
Sequence:CCGGCACAGAGGATACCATTGTCTTCTCGAGAAGACAATGGTATCCTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-554s21c1
Sequence:CCGGAGGAGAAATTCACCGCCTTCTCTCGAGAGAAGGCGGTGAATTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-170s21c1
Sequence:CCGGCCAACTTCCAGCAGGACAAGTCTCGAGACTTGTCCTGCTGGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-540s1c1
Sequence:CCGGCAGGGCTGAGTTAAAGGAGAACTCGAGTTCTCCTTTAACTCAGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-417s21c1
Sequence:CCGGCACCTACTCCGTGTCAGTGGTCTCGAGACCACTGACACGGAGTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-440s21c1
Sequence:CCGGAGACCGACTACGACCAGTACGCTCGAGCGTACTGGTCGTAGTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000954
PTGDS MISSION shRNA Lentiviral Transduction Particles
prostaglandin D2 synthase 21kDa (brain)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-304s21c1
Sequence:CCGGCTCAACCTGACCTCCACCTTCCTCGAGGAAGGTGGAGGTCAGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-337s21c1
Sequence:CCGGCAGTGTGAGACCCGAACCATGCTCGAGCATGGTTCGGGTCTCACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-625s1c1
Sequence:CCGGGATAAGTGCATGACGGAACAACTCGAGTTGTTCCGTCATGCACTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-256s1c1
Sequence:CCGGGCGTTGTCCATGTGCAAGTCTCTCGAGAGACTTGCACATGGACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-591s1c1
Sequence:CCGGCACAGAGGATACCATTGTCTTCTCGAGAAGACAATGGTATCCTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-554s21c1
Sequence:CCGGAGGAGAAATTCACCGCCTTCTCTCGAGAGAAGGCGGTGAATTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-170s21c1
Sequence:CCGGCCAACTTCCAGCAGGACAAGTCTCGAGACTTGTCCTGCTGGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000954.5-540s1c1
Sequence:CCGGCAGGGCTGAGTTAAAGGAGAACTCGAGTTCTCCTTTAACTCAGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-417s21c1
Sequence:CCGGCACCTACTCCGTGTCAGTGGTCTCGAGACCACTGACACGGAGTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000954.5-440s21c1
Sequence:CCGGAGACCGACTACGACCAGTACGCTCGAGCGTACTGGTCGTAGTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008963
VALIDATED
PTGDS MISSION shRNA Bacterial Glycerol Stock
prostaglandin D2 synthase 21kDa (brain)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-560s21c1
Sequence:CCGGGAAATTCACCACCTTTAGCAACTCGAGTTGCTAAAGGTGGTGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-315s21c1
Sequence:CCGGACCTCTACCTTCCTCAGGAAACTCGAGTTTCCTGAGGAAGGTAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-321s1c1
Sequence:CCGGCCAGTGTGAGACCAAGATCATCTCGAGATGATCTTGGTCTCACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-604s1c1
Sequence:CCGGCAACCGGATAAGTGCATTCAACTCGAGTTGAATGCACTTATCCGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008963.1-204s1c1
Sequence:CCGGCGCCTCCAACTCAAGCTGGTTCTCGAGAACCAGCTTGAGTTGGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-152s1c1
Sequence:CCGGGCCCAACTTTCAACAAGACAACTCGAGTTGTCTTGTTGAAAGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-635s1c1
Sequence:CCGGAGGTGAGAGAAGTCAGTCAGACTCGAGTCTGACTGACTTCTCTCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-255s21c1
Sequence:CCGGGCTGTATTGTATATGTGCAAGCTCGAGCTTGCACATATACAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008963
VALIDATED
PTGDS MISSION shRNA shRNA Plasmid DNA
prostaglandin D2 synthase 21kDa (brain)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-560s21c1
Sequence:CCGGGAAATTCACCACCTTTAGCAACTCGAGTTGCTAAAGGTGGTGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-315s21c1
Sequence:CCGGACCTCTACCTTCCTCAGGAAACTCGAGTTTCCTGAGGAAGGTAGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-321s1c1
Sequence:CCGGCCAGTGTGAGACCAAGATCATCTCGAGATGATCTTGGTCTCACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-604s1c1
Sequence:CCGGCAACCGGATAAGTGCATTCAACTCGAGTTGAATGCACTTATCCGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008963.1-204s1c1
Sequence:CCGGCGCCTCCAACTCAAGCTGGTTCTCGAGAACCAGCTTGAGTTGGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-152s1c1
Sequence:CCGGGCCCAACTTTCAACAAGACAACTCGAGTTGTCTTGTTGAAAGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-635s1c1
Sequence:CCGGAGGTGAGAGAAGTCAGTCAGACTCGAGTCTGACTGACTTCTCTCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-255s21c1
Sequence:CCGGGCTGTATTGTATATGTGCAAGCTCGAGCTTGCACATATACAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008963
VALIDATED
PTGDS MISSION shRNA Lentiviral Transduction Particles
prostaglandin D2 synthase 21kDa (brain)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-560s21c1
Sequence:CCGGGAAATTCACCACCTTTAGCAACTCGAGTTGCTAAAGGTGGTGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-315s21c1
Sequence:CCGGACCTCTACCTTCCTCAGGAAACTCGAGTTTCCTGAGGAAGGTAGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-321s1c1
Sequence:CCGGCCAGTGTGAGACCAAGATCATCTCGAGATGATCTTGGTCTCACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-604s1c1
Sequence:CCGGCAACCGGATAAGTGCATTCAACTCGAGTTGAATGCACTTATCCGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008963.1-204s1c1
Sequence:CCGGCGCCTCCAACTCAAGCTGGTTCTCGAGAACCAGCTTGAGTTGGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-152s1c1
Sequence:CCGGGCCCAACTTTCAACAAGACAACTCGAGTTGTCTTGTTGAAAGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008963.1-635s1c1
Sequence:CCGGAGGTGAGAGAAGTCAGTCAGACTCGAGTCTGACTGACTTCTCTCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008963.2-255s21c1
Sequence:CCGGGCTGTATTGTATATGTGCAAGCTCGAGCTTGCACATATACAATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)