EMAIL THIS PAGE TO A FRIEND

PTGER2

prostaglandin E receptor 2 (subtype EP2), 53kDa

151 Gene Product Result for
Synonyms: EP2
UniProtKB ID: P43116, D3DSC0, Q52LG8
Gene ID:
Human(5732) Summary: This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]
Mouse(19217) prostaglandin E receptor 2 (subtype EP2)
Rat(81752) prostaglandin E receptor 2 (subtype EP2)
chicken(100034745) prostaglandin E receptor 2 (subtype EP2), 53kDa
Horse(100067279) prostaglandin E receptor 2 (subtype EP2), 53kDa
domestic cat(100169967) prostaglandin E receptor 2 (subtype EP2), 53kDa
dog(403797) prostaglandin E receptor 2 (subtype EP2), 53kDa
domestic guinea pig(100730468) prostaglandin E receptor 2 (subtype EP2), 53kDa
Domestic Rabbit(100009369) prostaglandin E receptor 2 (subtype EP2), 53kDa
naked mole-rat(101718143) prostaglandin E receptor 2 (subtype EP2), 53kDa
cow(282329) prostaglandin E receptor 2 (subtype EP2), 53kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000956 Rosetta Predictions human pricing
NM_031088 Rosetta Predictions rat pricing
NM_008964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158176 predicted 1552
2 SASI_Hs01_00158177 predicted 1379
3 SASI_Hs02_00303568 predicted 1278
4 SASI_Hs01_00158178 predicted 1488
5 SASI_Hs01_00158179 predicted 1621
6 SASI_Hs02_00303569 predicted 1393
7 SASI_Hs01_00158180 predicted 1222
8 SASI_Hs01_00158182 predicted 1124
9 SASI_Hs01_00158183 predicted 1632
10 SASI_Hs01_00158184 predicted 1684
11 SASI_Hs01_00158181 predicted 1211
12 SASI_Hs01_00158185 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070520 predicted 1091
2 SASI_Rn01_00070521 predicted 890
3 SASI_Rn01_00070522 predicted 791
4 SASI_Rn01_00070523 predicted 690
5 SASI_Rn01_00070524 predicted 962
6 SASI_Rn01_00070525 predicted 404
7 SASI_Rn01_00070526 predicted 373
8 SASI_Rn02_00264331 predicted 1041
9 SASI_Rn01_00070528 predicted 854
10 SASI_Rn01_00070529 predicted 711
11 SASI_Rn01_00070527 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165745 predicted 1017
2 SASI_Mm01_00165746 predicted 1439
3 SASI_Mm01_00165747 predicted 1079
4 SASI_Mm01_00165748 predicted 696
5 SASI_Mm01_00165749 predicted 1541
6 SASI_Mm01_00165750 predicted 1395
7 SASI_Mm01_00165751 predicted 394
8 SASI_Mm01_00165752 predicted 1222
9 SASI_Mm01_00165753 predicted 587
10 SASI_Mm02_00315039 predicted 1460
11 SASI_Mm01_00165744 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000956
PTGER2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 2 (subtype EP2), 53kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1078s21c1
Sequence:CCGGGCTCCTTGCCTTTCACGATTTCTCGAGAAATCGTGAAAGGCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1357s21c1
Sequence:CCGGATAGCATCTGGAAGATCATTTCTCGAGAAATGATCTTCCAGATGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1294s21c1
Sequence:CCGGCACAGTCAGATGCCAGTAAACCTCGAGGTTTACTGGCATCTGACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-791s1c1
Sequence:CCGGGCCTGCAACTTCAGTGTCATTCTCGAGAATGACACTGAAGTTGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1208s1c1
Sequence:CCGGGCCAGTAAACAGGCTGACCTTCTCGAGAAGGTCAGCCTGTTTACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000956.2-2025s1c1
Sequence:CCGGGCCATGTATGAAGCCAAATATCTCGAGATATTTGGCTTCATACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1012s1c1
Sequence:CCGGGAATGAAACCTCTTCCCGAAACTCGAGTTTCGGGAAGAGGTTTCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1714s21c1
Sequence:CCGGGTACAGCCAGACCAGATTAAACTCGAGTTTAATCTGGTCTGGCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1151s1c1
Sequence:CCGGCGGATTTCATTAAGAACACAACTCGAGTTGTGTTCTTAATGAAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000956
PTGER2 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 2 (subtype EP2), 53kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1078s21c1
Sequence:CCGGGCTCCTTGCCTTTCACGATTTCTCGAGAAATCGTGAAAGGCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1357s21c1
Sequence:CCGGATAGCATCTGGAAGATCATTTCTCGAGAAATGATCTTCCAGATGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1294s21c1
Sequence:CCGGCACAGTCAGATGCCAGTAAACCTCGAGGTTTACTGGCATCTGACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-791s1c1
Sequence:CCGGGCCTGCAACTTCAGTGTCATTCTCGAGAATGACACTGAAGTTGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1208s1c1
Sequence:CCGGGCCAGTAAACAGGCTGACCTTCTCGAGAAGGTCAGCCTGTTTACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000956.2-2025s1c1
Sequence:CCGGGCCATGTATGAAGCCAAATATCTCGAGATATTTGGCTTCATACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1012s1c1
Sequence:CCGGGAATGAAACCTCTTCCCGAAACTCGAGTTTCGGGAAGAGGTTTCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1714s21c1
Sequence:CCGGGTACAGCCAGACCAGATTAAACTCGAGTTTAATCTGGTCTGGCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1151s1c1
Sequence:CCGGCGGATTTCATTAAGAACACAACTCGAGTTGTGTTCTTAATGAAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000956
PTGER2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 2 (subtype EP2), 53kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1078s21c1
Sequence:CCGGGCTCCTTGCCTTTCACGATTTCTCGAGAAATCGTGAAAGGCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1357s21c1
Sequence:CCGGATAGCATCTGGAAGATCATTTCTCGAGAAATGATCTTCCAGATGCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000956.3-1294s21c1
Sequence:CCGGCACAGTCAGATGCCAGTAAACCTCGAGGTTTACTGGCATCTGACTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-791s1c1
Sequence:CCGGGCCTGCAACTTCAGTGTCATTCTCGAGAATGACACTGAAGTTGCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1208s1c1
Sequence:CCGGGCCAGTAAACAGGCTGACCTTCTCGAGAAGGTCAGCCTGTTTACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000956.2-2025s1c1
Sequence:CCGGGCCATGTATGAAGCCAAATATCTCGAGATATTTGGCTTCATACATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1012s1c1
Sequence:CCGGGAATGAAACCTCTTCCCGAAACTCGAGTTTCGGGAAGAGGTTTCATTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000956.3-1714s21c1
Sequence:CCGGGTACAGCCAGACCAGATTAAACTCGAGTTTAATCTGGTCTGGCTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000956.2-1151s1c1
Sequence:CCGGCGGATTTCATTAAGAACACAACTCGAGTTGTGTTCTTAATGAAATCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008964
PTGER2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 2 (subtype EP2), 53kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1226s1c1
Sequence:CCGGCCTACATGGATGAAACCTCTTCTCGAGAAGAGGTTTCATCCATGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-699s1c1
Sequence:CCGGCGCGTGTACCTATTTCGCTTTCTCGAGAAAGCGAAATAGGTACACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1430s1c1
Sequence:CCGGCCAGTAAACAGACTGACCTTTCTCGAGAAAGGTCAGTCTGTTTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1309s1c1
Sequence:CCGGCCTTGGGTCTTTGCCATACTTCTCGAGAAGTATGGCAAAGACCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-715s1c1
Sequence:CCGGGCTTTCACTATGACCTTCTTTCTCGAGAAAGAAGGTCATAGTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008964
PTGER2 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 2 (subtype EP2), 53kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1226s1c1
Sequence:CCGGCCTACATGGATGAAACCTCTTCTCGAGAAGAGGTTTCATCCATGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-699s1c1
Sequence:CCGGCGCGTGTACCTATTTCGCTTTCTCGAGAAAGCGAAATAGGTACACGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1430s1c1
Sequence:CCGGCCAGTAAACAGACTGACCTTTCTCGAGAAAGGTCAGTCTGTTTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1309s1c1
Sequence:CCGGCCTTGGGTCTTTGCCATACTTCTCGAGAAGTATGGCAAAGACCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-715s1c1
Sequence:CCGGGCTTTCACTATGACCTTCTTTCTCGAGAAAGAAGGTCATAGTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008964
PTGER2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 2 (subtype EP2), 53kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1226s1c1
Sequence:CCGGCCTACATGGATGAAACCTCTTCTCGAGAAGAGGTTTCATCCATGTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-699s1c1
Sequence:CCGGCGCGTGTACCTATTTCGCTTTCTCGAGAAAGCGAAATAGGTACACGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1430s1c1
Sequence:CCGGCCAGTAAACAGACTGACCTTTCTCGAGAAAGGTCAGTCTGTTTACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-1309s1c1
Sequence:CCGGCCTTGGGTCTTTGCCATACTTCTCGAGAAGTATGGCAAAGACCCAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008964.2-715s1c1
Sequence:CCGGGCTTTCACTATGACCTTCTTTCTCGAGAAAGAAGGTCATAGTGAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)