EMAIL THIS PAGE TO A FRIEND

PTGES2-AS1

PTGES2 antisense RNA 1 (head to head)

42 Gene Product Result for
Species: Human PTGES2-AS1(389791)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013652 Rosetta Predictions human pricing
XR_041544 Rosetta Predictions human pricing
XR_041545 Rosetta Predictions human pricing
XR_041546 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192975 predicted 612
2 SASI_Hs01_00192976 predicted 672
3 SASI_Hs01_00192977 predicted 666
4 SASI_Hs01_00192978 predicted 646
5 SASI_Hs01_00192979 predicted 638
6 SASI_Hs01_00192980 predicted 617
7 SASI_Hs01_00192981 predicted 644
8 SASI_Hs01_00192982 predicted 639
9 SASI_Hs01_00192983 predicted 661
10 SASI_Hs01_00192984 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528241 predicted 472
2 SASI_Hs02_00528242 predicted 330
3 SASI_Hs02_00528243 predicted 682
4 SASI_Hs02_00528244 predicted 888
5 SASI_Hs02_00528245 predicted 107
6 SASI_Hs02_00528246 predicted 648
7 SASI_Hs02_00528247 predicted 533
8 SASI_Hs02_00528248 predicted 875
9 SASI_Hs02_00528249 predicted 49
10 SASI_Hs02_00528250 predicted 117
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528251 predicted 642
2 SASI_Hs02_00528252 predicted 694
3 SASI_Hs02_00528253 predicted 694
4 SASI_Hs02_00528254 predicted 675
5 SASI_Hs02_00528255 predicted 674
6 SASI_Hs02_00528256 predicted 649
7 SASI_Hs02_00528257 predicted 677
8 SASI_Hs02_00528258 predicted 695
9 SASI_Hs02_00528259 predicted 638
10 SASI_Hs02_00528260 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528261 predicted 651
2 SASI_Hs02_00528262 predicted 697
3 SASI_Hs02_00528263 predicted 700
4 SASI_Hs02_00528264 predicted 667
5 SASI_Hs02_00528265 predicted 670
6 SASI_Hs02_00528266 predicted 651
7 SASI_Hs02_00528267 predicted 671
8 SASI_Hs02_00528268 predicted 693
9 SASI_Hs02_00528269 predicted 639
10 SASI_Hs02_00528270 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013652
PTGES2-AS1 MISSION shRNA Bacterial Glycerol Stock
PTGES2 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-609s1c1
Sequence:CCGGGCTTCATCCTCCTCCTGTTTACTCGAGTAAACAGGAGGAGGATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-426s1c1
Sequence:CCGGCCACTTCCTTCAGCCACTTTACTCGAGTAAAGTGGCTGAAGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-439s1c1
Sequence:CCGGCCACTTTACAGACCAGGAGTTCTCGAGAACTCCTGGTCTGTAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-508s1c1
Sequence:CCGGCCATGTTCTGTGCTCTACTCTCTCGAGAGAGTAGAGCACAGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013652.1-1255s1c1
Sequence:CCGGCGCCATTATTTCTGCATATCACTCGAGTGATATGCAGAAATAATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013652
PTGES2-AS1 MISSION shRNA shRNA Plasmid DNA
PTGES2 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-609s1c1
Sequence:CCGGGCTTCATCCTCCTCCTGTTTACTCGAGTAAACAGGAGGAGGATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-426s1c1
Sequence:CCGGCCACTTCCTTCAGCCACTTTACTCGAGTAAAGTGGCTGAAGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-439s1c1
Sequence:CCGGCCACTTTACAGACCAGGAGTTCTCGAGAACTCCTGGTCTGTAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-508s1c1
Sequence:CCGGCCATGTTCTGTGCTCTACTCTCTCGAGAGAGTAGAGCACAGAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013652.1-1255s1c1
Sequence:CCGGCGCCATTATTTCTGCATATCACTCGAGTGATATGCAGAAATAATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013652
PTGES2-AS1 MISSION shRNA Lentiviral Transduction Particles
PTGES2 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-609s1c1
Sequence:CCGGGCTTCATCCTCCTCCTGTTTACTCGAGTAAACAGGAGGAGGATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-426s1c1
Sequence:CCGGCCACTTCCTTCAGCCACTTTACTCGAGTAAAGTGGCTGAAGGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-439s1c1
Sequence:CCGGCCACTTTACAGACCAGGAGTTCTCGAGAACTCCTGGTCTGTAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013652.1-508s1c1
Sequence:CCGGCCATGTTCTGTGCTCTACTCTCTCGAGAGAGTAGAGCACAGAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013652.1-1255s1c1
Sequence:CCGGCGCCATTATTTCTGCATATCACTCGAGTGATATGCAGAAATAATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)