EMAIL THIS PAGE TO A FRIEND

PTGES2

prostaglandin E synthase 2

176 Gene Product Result for
Synonyms: C9orf15 GBF-1 GBF1 PGES2 mPGES-2
UniProtKB ID: Q9H7Z7, Q53EW9, Q5SYV6, Q96GI0, Q96GL2
Gene ID:
Human(80142) Summary: The protein encoded by this gene is a membrane-associated prostaglandin E synthase, which catalyzes the conversion of prostaglandin H2 to prostaglandin E2. This protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE). Multiple transcript variants have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(96979) prostaglandin E synthase 2
Rat(311865) prostaglandin E synthase 2
domestic guinea pig(100725206) prostaglandin E synthase 2
naked mole-rat(101712155) prostaglandin E synthase 2
cow(493639) prostaglandin E synthase 2
sheep(100294563) prostaglandin E synthase 2
sheep(101109261) prostaglandin E synthase 2
chicken(417214) prostaglandin E synthase 2
domestic cat(101098264) prostaglandin E synthase 2
dog(609101) prostaglandin E synthase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025072 Rosetta Predictions human pricing
NM_198938 Rosetta Predictions human pricing
NM_198939 Rosetta Predictions human pricing
NM_198940 Rosetta Predictions human pricing
NM_001107832 Rosetta Predictions rat pricing
NM_133783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046708 predicted 1514
2 SASI_Hs01_00046709 predicted 1775
3 SASI_Hs01_00046710 predicted 1776
4 SASI_Hs01_00046711 predicted 1540
5 SASI_Hs01_00046712 predicted 1160
6 SASI_Hs01_00046713 predicted 1482
7 SASI_Hs01_00046715 predicted 1451
8 SASI_Hs01_00046716 predicted 1471
9 SASI_Hs01_00046717 predicted 1323
10 SASI_Hs02_00357733 predicted 892
11 SASI_Hs01_00046714 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109045 predicted 1033
2 SASI_Hs01_00109046 predicted 1296
3 SASI_Hs01_00109047 predicted 1298
4 SASI_Hs01_00109048 predicted 1067
5 SASI_Hs01_00109049 predicted 690
6 SASI_Hs01_00109050 predicted 1001
7 SASI_Hs01_00109052 predicted 978
8 SASI_Hs01_00109053 predicted 995
9 SASI_Hs01_00109054 predicted 848
10 SASI_Hs02_00372437 predicted 596
11 SASI_Hs01_00109051 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039655 predicted 1267
2 SASI_Hs01_00039656 predicted 1420
3 SASI_Hs01_00039657 predicted 896
4 SASI_Hs01_00039658 predicted 1167
5 SASI_Hs01_00039659 predicted 1037
6 SASI_Hs01_00039660 predicted 1183
7 SASI_Hs01_00039661 predicted 948
8 SASI_Hs01_00039662 predicted 1051
9 SASI_Hs01_00039663 predicted 1151
10 SASI_Hs01_00039664 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225925 predicted 947
2 SASI_Hs01_00225926 predicted 1212
3 SASI_Hs01_00225927 predicted 1208
4 SASI_Hs01_00225928 predicted 972
5 SASI_Hs01_00225929 predicted 594
6 SASI_Hs01_00225930 predicted 914
7 SASI_Hs01_00225932 predicted 885
8 SASI_Hs01_00225933 predicted 902
9 SASI_Hs01_00225934 predicted 760
10 SASI_Hs02_00372438 predicted 504
11 SASI_Hs01_00225931 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232715 predicted 1071
2 SASI_Rn02_00232716 predicted 989
3 SASI_Rn02_00232717 predicted 1103
4 SASI_Rn02_00232718 predicted 1220
5 SASI_Rn02_00232719 predicted 1080
6 SASI_Rn02_00232720 predicted 1621
7 SASI_Rn02_00232721 predicted 804
8 SASI_Rn02_00232722 predicted 1782
9 SASI_Rn02_00232723 predicted 1605
10 SASI_Rn02_00232724 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144234 predicted 603
2 SASI_Mm01_00144235 predicted 1107
3 SASI_Mm01_00144236 predicted 419
4 SASI_Mm01_00144238 predicted 496
5 SASI_Mm02_00338809 predicted 473
6 SASI_Mm01_00144239 predicted 581
7 SASI_Mm01_00144240 predicted 388
8 SASI_Mm01_00144241 predicted 400
9 SASI_Mm01_00144242 predicted 314
10 SASI_Mm01_00144243 predicted 314
11 SASI_Mm01_00144237 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133783
VALIDATED
PTGES2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E synthase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-416s21c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133783.1-1254s21c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-932s21c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-497s21c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1254s1c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-497s1c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-932s1c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1138s1c1
Sequence:CCGGCGGTGCATCATGTCAACCCTACTCGAGTAGGGTTGACATGATGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-416s1c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133783
VALIDATED
PTGES2 MISSION shRNA shRNA Plasmid DNA
prostaglandin E synthase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-416s21c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133783.1-1254s21c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-932s21c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-497s21c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1254s1c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-497s1c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-932s1c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1138s1c1
Sequence:CCGGCGGTGCATCATGTCAACCCTACTCGAGTAGGGTTGACATGATGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-416s1c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133783
VALIDATED
PTGES2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E synthase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-416s21c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133783.1-1254s21c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-932s21c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133783.1-497s21c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1254s1c1
Sequence:CCGGCCCAGTTCTCTGCTTCTGATACTCGAGTATCAGAAGCAGAGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-497s1c1
Sequence:CCGGGCTCAATGACTCCTCTGTCATCTCGAGATGACAGAGGAGTCATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-932s1c1
Sequence:CCGGCCTCTATGAAGCAGCCAACAACTCGAGTTGTTGGCTGCTTCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-1138s1c1
Sequence:CCGGCGGTGCATCATGTCAACCCTACTCGAGTAGGGTTGACATGATGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133783.1-416s1c1
Sequence:CCGGCGTGAGAAGGACTGAGATCAACTCGAGTTGATCTCAGTCCTTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025072
VALIDATED
PTGES2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E synthase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1923s21c1
Sequence:CCGGAGGACAGCAGGACGGTTTGTTCTCGAGAACAAACCGTCCTGCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1250s21c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-1462s21c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1339s21c1
Sequence:CCGGCCTCATCAGCAAGCGACTCAACTCGAGTTGAGTCGCTTGCTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-954s21c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1250s1c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1093s1c1
Sequence:CCGGCGGCAATAAGTACTGGCTCATCTCGAGATGAGCCAGTACTTATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1462s1c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-954s1c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1021s1c1
Sequence:CCGGCCTGGAAGAGATCATCACCTACTCGAGTAGGTGATGATCTCTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025072
VALIDATED
PTGES2 MISSION shRNA shRNA Plasmid DNA
prostaglandin E synthase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1923s21c1
Sequence:CCGGAGGACAGCAGGACGGTTTGTTCTCGAGAACAAACCGTCCTGCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1250s21c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-1462s21c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1339s21c1
Sequence:CCGGCCTCATCAGCAAGCGACTCAACTCGAGTTGAGTCGCTTGCTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-954s21c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1250s1c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1093s1c1
Sequence:CCGGCGGCAATAAGTACTGGCTCATCTCGAGATGAGCCAGTACTTATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1462s1c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-954s1c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1021s1c1
Sequence:CCGGCCTGGAAGAGATCATCACCTACTCGAGTAGGTGATGATCTCTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025072
VALIDATED
PTGES2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E synthase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1923s21c1
Sequence:CCGGAGGACAGCAGGACGGTTTGTTCTCGAGAACAAACCGTCCTGCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1250s21c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-1462s21c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025072.4-1339s21c1
Sequence:CCGGCCTCATCAGCAAGCGACTCAACTCGAGTTGAGTCGCTTGCTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025072.4-954s21c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1250s1c1
Sequence:CCGGCTGGCGTCCTTTGACTACATTCTCGAGAATGTAGTCAAAGGACGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1093s1c1
Sequence:CCGGCGGCAATAAGTACTGGCTCATCTCGAGATGAGCCAGTACTTATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-1462s1c1
Sequence:CCGGGAAGCCGAATCTCGCTGATTTCTCGAGAAATCAGCGAGATTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025072.4-954s1c1
Sequence:CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025072.4-1021s1c1
Sequence:CCGGCCTGGAAGAGATCATCACCTACTCGAGTAGGTGATGATCTCTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)