EMAIL THIS PAGE TO A FRIEND

PTGES3L

prostaglandin E synthase 3 (cytosolic)-like

15 Gene Product Result for
UniProtKB ID: E9PB15
Gene ID:
Mouse(73635) prostaglandin E synthase 3 (cytosolic)-like
sheep(101107537) prostaglandin E synthase 3 (cytosolic)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_026865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103215 predicted 1004
2 SASI_Mm01_00103216 predicted 731
3 SASI_Mm01_00103217 predicted 970
4 SASI_Mm01_00103218 predicted 907
5 SASI_Mm01_00103219 predicted 841
6 SASI_Mm02_00331086 predicted 1210
7 SASI_Mm01_00103221 predicted 738
8 SASI_Mm02_00331087 predicted 1063
9 SASI_Mm01_00103223 predicted 1195
10 SASI_Mm02_00331088 predicted 1095
11 SASI_Mm01_00103214 predicted 1219
12 SASI_Mm01_00103220 predicted 838
13 SASI_Mm01_00103222 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026865
VALIDATED
PTGES3L MISSION shRNA Bacterial Glycerol Stock
prostaglandin E synthase 3 (cytosolic)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026865.1-1179s1c1
Sequence:CCGGGCCTTCTTCAACTACTTGGTTCTCGAGAACCAAGTAGTTGAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-974s1c1
Sequence:CCGGAGGCTCACAAAGGAGGATATACTCGAGTATATCCTCCTTTGTGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-1006s1c1
Sequence:CCGGGCTCTCTGTGGACTTCGATAACTCGAGTTATCGAAGTCCACAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-928s1c1
Sequence:CCGGCATTACTTGCTTTGTGAGGAACTCGAGTTCCTCACAAAGCAAGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-854s1c1
Sequence:CCGGGAGCTGTATAACGAGATTGAACTCGAGTTCAATCTCGTTATACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026865
VALIDATED
PTGES3L MISSION shRNA shRNA Plasmid DNA
prostaglandin E synthase 3 (cytosolic)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026865.1-1179s1c1
Sequence:CCGGGCCTTCTTCAACTACTTGGTTCTCGAGAACCAAGTAGTTGAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-974s1c1
Sequence:CCGGAGGCTCACAAAGGAGGATATACTCGAGTATATCCTCCTTTGTGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-1006s1c1
Sequence:CCGGGCTCTCTGTGGACTTCGATAACTCGAGTTATCGAAGTCCACAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-928s1c1
Sequence:CCGGCATTACTTGCTTTGTGAGGAACTCGAGTTCCTCACAAAGCAAGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-854s1c1
Sequence:CCGGGAGCTGTATAACGAGATTGAACTCGAGTTCAATCTCGTTATACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026865
VALIDATED
PTGES3L MISSION shRNA Lentiviral Transduction Particles
prostaglandin E synthase 3 (cytosolic)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026865.1-1179s1c1
Sequence:CCGGGCCTTCTTCAACTACTTGGTTCTCGAGAACCAAGTAGTTGAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-974s1c1
Sequence:CCGGAGGCTCACAAAGGAGGATATACTCGAGTATATCCTCCTTTGTGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-1006s1c1
Sequence:CCGGGCTCTCTGTGGACTTCGATAACTCGAGTTATCGAAGTCCACAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-928s1c1
Sequence:CCGGCATTACTTGCTTTGTGAGGAACTCGAGTTCCTCACAAAGCAAGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026865.1-854s1c1
Sequence:CCGGGAGCTGTATAACGAGATTGAACTCGAGTTCAATCTCGTTATACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)