EMAIL THIS PAGE TO A FRIEND

PTGFR

prostaglandin F receptor (FP)

231 Gene Product Result for
Synonyms: FP
UniProtKB ID: P43088, A8K9Y0, Q2KHP3, Q6RYQ6, Q9P1X4
Gene ID:
Human(5737) Summary: The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19220) prostaglandin F receptor
Rat(25652) prostaglandin F receptor
Zebrafish(571808) prostaglandin F receptor (FP)
chicken(424548) prostaglandin F receptor (FP)
dog(479981) prostaglandin F receptor (FP)
domestic cat(493933) prostaglandin F receptor (FP)
Horse(100009714) prostaglandin F receptor (FP)
domestic guinea pig(100735880) prostaglandin F receptor (FP)
naked mole-rat(101698053) prostaglandin F receptor (FP)
cow(282020) prostaglandin F receptor (FP)
sheep(443366) prostaglandin F receptor (FP)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P8622 Anti-FP Prostanoid Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900625 Anti-PTGFR antibody produced in rabbit affinity isolated antibody mouse, horse, chicken, rabbit, human, dog
immunohistochemistry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A3846 AL-8810 ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000959 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000959 Rosetta Predictions human pricing
NM_001039585 Rosetta Predictions human pricing
NM_013115 Rosetta Predictions rat pricing
NM_008966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081194 predicted 1381
2 SASI_Hs01_00081195 predicted 662
3 SASI_Hs01_00081196 predicted 415
4 SASI_Hs01_00081197 predicted 523
5 SASI_Hs01_00081198 predicted 649
6 SASI_Hs01_00081199 predicted 680
7 SASI_Hs01_00081200 predicted 1341
8 SASI_Hs01_00081202 predicted 486
9 SASI_Hs01_00081203 predicted 422
10 SASI_Hs02_00303573 predicted 1408
11 SASI_Hs01_00081201 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150632 predicted 1455
2 SASI_Hs01_00150633 predicted 655
3 SASI_Hs01_00150634 predicted 412
4 SASI_Hs01_00150635 predicted 527
5 SASI_Hs01_00150636 predicted 654
6 SASI_Hs01_00150637 predicted 680
7 SASI_Hs01_00150638 predicted 1408
8 SASI_Hs01_00150640 predicted 487
9 SASI_Hs01_00150641 predicted 418
10 SASI_Hs02_00308592 predicted 1410
11 SASI_Hs01_00150639 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103949 predicted 550
2 SASI_Rn01_00103950 predicted 937
3 SASI_Rn01_00103951 predicted 1287
4 SASI_Rn02_00260895 predicted 660
5 SASI_Rn01_00103952 predicted 549
6 SASI_Rn01_00103954 predicted 443
7 SASI_Rn01_00103955 predicted 354
8 SASI_Rn01_00103956 predicted 1222
9 SASI_Rn01_00103957 predicted 297
10 SASI_Rn01_00103958 predicted 1142
11 SASI_Rn01_00103953 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067284 predicted 1264
2 SASI_Mm01_00067285 predicted 1385
3 SASI_Mm01_00067286 predicted 601
4 SASI_Mm01_00067287 predicted 723
5 SASI_Mm01_00067288 predicted 1389
6 SASI_Mm01_00067289 predicted 1053
7 SASI_Mm01_00067290 predicted 1452
8 SASI_Mm01_00067291 predicted 1228
9 SASI_Mm01_00067292 predicted 1312
10 SASI_Mm01_00067293 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008966
PTGFR MISSION shRNA Bacterial Glycerol Stock
prostaglandin F receptor (FP)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1132s1c1
Sequence:CCGGGCTGTCCTTAGGAACCTGTATCTCGAGATACAGGTTCCTAAGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-811s21c1
Sequence:CCGGTCCTTGGACACCGAGATTATCCTCGAGGATAATCTCGGTGTCCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-729s21c1
Sequence:CCGGTCTACGAAGATCACATCTAAACTCGAGTTTAGATGTGATCTTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-445s1c1
Sequence:CCGGCACCTTATCAACGGAGGCATACTCGAGTATGCCTCCGTTGATAAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-617s1c1
Sequence:CCGGCCAATCCTATATTTCACTCTACTCGAGTAGAGTGAAATATAGGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1226s1c1
Sequence:CCGGCCTTAAAGGTTGCTGCTATTTCTCGAGAAATAGCAGCAACCTTTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-704s21c1
Sequence:CCGGAGGAGTCACCAATCCTATATTCTCGAGAATATAGGATTGGTGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008966.3-1451s21c1
Sequence:CCGGTGATCCGACTCATCGTGTAACCTCGAGGTTACACGATGAGTCGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1105s1c1
Sequence:CCGGCCCTGGGTCTATATTCTGCTACTCGAGTAGCAGAATATAGACCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-1194s21c1
Sequence:CCGGTTAGATCCCTGGGTCTATATTCTCGAGAATATAGACCCAGGGATCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008966
PTGFR MISSION shRNA shRNA Plasmid DNA
prostaglandin F receptor (FP)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1132s1c1
Sequence:CCGGGCTGTCCTTAGGAACCTGTATCTCGAGATACAGGTTCCTAAGGACAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-811s21c1
Sequence:CCGGTCCTTGGACACCGAGATTATCCTCGAGGATAATCTCGGTGTCCAAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-729s21c1
Sequence:CCGGTCTACGAAGATCACATCTAAACTCGAGTTTAGATGTGATCTTCGTAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000027927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-445s1c1
Sequence:CCGGCACCTTATCAACGGAGGCATACTCGAGTATGCCTCCGTTGATAAGGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000027865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-617s1c1
Sequence:CCGGCCAATCCTATATTTCACTCTACTCGAGTAGAGTGAAATATAGGATTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000027910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1226s1c1
Sequence:CCGGCCTTAAAGGTTGCTGCTATTTCTCGAGAAATAGCAGCAACCTTTAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-704s21c1
Sequence:CCGGAGGAGTCACCAATCCTATATTCTCGAGAATATAGGATTGGTGACTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008966.3-1451s21c1
Sequence:CCGGTGATCCGACTCATCGTGTAACCTCGAGGTTACACGATGAGTCGGATCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000027916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1105s1c1
Sequence:CCGGCCCTGGGTCTATATTCTGCTACTCGAGTAGCAGAATATAGACCCAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-1194s21c1
Sequence:CCGGTTAGATCCCTGGGTCTATATTCTCGAGAATATAGACCCAGGGATCTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008966
PTGFR MISSION shRNA Lentiviral Transduction Particles
prostaglandin F receptor (FP)
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000027866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1132s1c1
Sequence:CCGGGCTGTCCTTAGGAACCTGTATCTCGAGATACAGGTTCCTAAGGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-811s21c1
Sequence:CCGGTCCTTGGACACCGAGATTATCCTCGAGGATAATCTCGGTGTCCAAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-729s21c1
Sequence:CCGGTCTACGAAGATCACATCTAAACTCGAGTTTAGATGTGATCTTCGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-445s1c1
Sequence:CCGGCACCTTATCAACGGAGGCATACTCGAGTATGCCTCCGTTGATAAGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-617s1c1
Sequence:CCGGCCAATCCTATATTTCACTCTACTCGAGTAGAGTGAAATATAGGATTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1226s1c1
Sequence:CCGGCCTTAAAGGTTGCTGCTATTTCTCGAGAAATAGCAGCAACCTTTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-704s21c1
Sequence:CCGGAGGAGTCACCAATCCTATATTCTCGAGAATATAGGATTGGTGACTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008966.3-1451s21c1
Sequence:CCGGTGATCCGACTCATCGTGTAACCTCGAGGTTACACGATGAGTCGGATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008966.2-1105s1c1
Sequence:CCGGCCCTGGGTCTATATTCTGCTACTCGAGTAGCAGAATATAGACCCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008966.3-1194s21c1
Sequence:CCGGTTAGATCCCTGGGTCTATATTCTCGAGAATATAGACCCAGGGATCTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000959
PTGFR MISSION shRNA Bacterial Glycerol Stock
prostaglandin F receptor (FP)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-482s1c1
Sequence:CCGGCCTGGTAATCACTGATTTCTTCTCGAGAAGAAATCAGTGATTACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-662s1c1
Sequence:CCGGGCGGTGTATTGGAGTCACAAACTCGAGTTTGTGACTCCAATACACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000959.2-1692s1c1
Sequence:CCGGGCCTGCATAGTGAAATGGTTACTCGAGTAACCATTTCACTATGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1252s1c1
Sequence:CCGGGCTTACATATTTGGGAGCTTACTCGAGTAAGCTCCCAAATATGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1194s1c1
Sequence:CCGGGCTGTCCTTAAGAATCTCTATCTCGAGATAGAGATTCTTAAGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-780s21c1
Sequence:CCGGCTTGGACATCGAGACTATAAACTCGAGTTTATAGTCTCGATGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000959.3-1399s21c1
Sequence:CCGGGGCAATATTTCAGTTAGTTAACTCGAGTTAACTAACTGAAATATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-651s21c1
Sequence:CCGGATGGCCATTGAGCGGTGTATTCTCGAGAATACACCGCTCAATGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-1159s21c1
Sequence:CCGGTCTTAGATCCTTGGGTATATACTCGAGTATATACCCAAGGATCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000959
PTGFR MISSION shRNA shRNA Plasmid DNA
prostaglandin F receptor (FP)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-482s1c1
Sequence:CCGGCCTGGTAATCACTGATTTCTTCTCGAGAAGAAATCAGTGATTACCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-662s1c1
Sequence:CCGGGCGGTGTATTGGAGTCACAAACTCGAGTTTGTGACTCCAATACACCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000959.2-1692s1c1
Sequence:CCGGGCCTGCATAGTGAAATGGTTACTCGAGTAACCATTTCACTATGCAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1252s1c1
Sequence:CCGGGCTTACATATTTGGGAGCTTACTCGAGTAAGCTCCCAAATATGTAAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1194s1c1
Sequence:CCGGGCTGTCCTTAAGAATCTCTATCTCGAGATAGAGATTCTTAAGGACAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000358055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-780s21c1
Sequence:CCGGCTTGGACATCGAGACTATAAACTCGAGTTTATAGTCTCGATGTCCAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000358067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000959.3-1399s21c1
Sequence:CCGGGGCAATATTTCAGTTAGTTAACTCGAGTTAACTAACTGAAATATTGCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000357986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-651s21c1
Sequence:CCGGATGGCCATTGAGCGGTGTATTCTCGAGAATACACCGCTCAATGGCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000358019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-1159s21c1
Sequence:CCGGTCTTAGATCCTTGGGTATATACTCGAGTATATACCCAAGGATCTAAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000959
PTGFR MISSION shRNA Lentiviral Transduction Particles
prostaglandin F receptor (FP)
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000014170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-482s1c1
Sequence:CCGGCCTGGTAATCACTGATTTCTTCTCGAGAAGAAATCAGTGATTACCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-662s1c1
Sequence:CCGGGCGGTGTATTGGAGTCACAAACTCGAGTTTGTGACTCCAATACACCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000959.2-1692s1c1
Sequence:CCGGGCCTGCATAGTGAAATGGTTACTCGAGTAACCATTTCACTATGCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1252s1c1
Sequence:CCGGGCTTACATATTTGGGAGCTTACTCGAGTAAGCTCCCAAATATGTAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000959.2-1194s1c1
Sequence:CCGGGCTGTCCTTAAGAATCTCTATCTCGAGATAGAGATTCTTAAGGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-780s21c1
Sequence:CCGGCTTGGACATCGAGACTATAAACTCGAGTTTATAGTCTCGATGTCCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000959.3-1399s21c1
Sequence:CCGGGGCAATATTTCAGTTAGTTAACTCGAGTTAACTAACTGAAATATTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-651s21c1
Sequence:CCGGATGGCCATTGAGCGGTGTATTCTCGAGAATACACCGCTCAATGGCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000959.3-1159s21c1
Sequence:CCGGTCTTAGATCCTTGGGTATATACTCGAGTATATACCCAAGGATCTAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)