EMAIL THIS PAGE TO A FRIEND

PTGIR

prostaglandin I2 (prostacyclin) receptor (IP)

111 Gene Product Result for
Synonyms: IP PRIPR
UniProtKB ID: P43119
Gene ID:
Human(5739) Summary: The protein encoded by this gene is a member of the G-protein coupled receptor family 1 and has been shown to be a receptor for prostacyclin. Prostacyclin, the major product of cyclooxygenase in macrovascular endothelium, elicits a potent vasodilation and inhibition of platelet aggregation through binding to this receptor. [provided by RefSeq, Jul 2008]
Mouse(19222) prostaglandin I receptor (IP)
Rat(292661) prostaglandin I2 (prostacyclin) receptor (IP)
domestic cat(101100609) prostaglandin I2 (prostacyclin) receptor (IP)
dog(484429) prostaglandin I2 (prostacyclin) receptor (IP)
domestic guinea pig(100716797) prostaglandin I2 (prostacyclin) receptor (IP)
naked mole-rat(101723810) prostaglandin I2 (prostacyclin) receptor (IP)
cow(520278) prostaglandin I2 (prostacyclin) receptor (IP)
sheep(101121448) prostaglandin I2 (prostacyclin) receptor (IP)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M6807 Misoprostol ≥99% (HPLC) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P5640 Prostaglandin E2 ≥93% (HPLC), synthetic human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000960 Rosetta Predictions human pricing
NM_001077644 Rosetta Predictions rat pricing
NM_008967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144457 predicted 1624
2 SASI_Hs01_00144459 predicted 868
3 SASI_Hs01_00144460 predicted 1471
4 SASI_Hs01_00144461 predicted 821
5 SASI_Hs01_00144462 predicted 745
6 SASI_Hs01_00144463 predicted 704
7 SASI_Hs01_00144464 predicted 1691
8 SASI_Hs01_00144465 predicted 384
9 SASI_Hs01_00144466 predicted 1330
10 SASI_Hs02_00303574 predicted 535
11 SASI_Hs01_00144458 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207672 predicted 438
2 SASI_Rn02_00207673 predicted 1063
3 SASI_Rn02_00207674 predicted 589
4 SASI_Rn02_00207675 predicted 588
5 SASI_Rn02_00207676 predicted 458
6 SASI_Rn02_00207677 predicted 373
7 SASI_Rn02_00207678 predicted 901
8 SASI_Rn02_00207679 predicted 227
9 SASI_Rn02_00207680 predicted 848
10 SASI_Rn02_00207681 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138200 predicted 1607
2 SASI_Mm02_00315041 predicted 1726
3 SASI_Mm01_00138202 predicted 1136
4 SASI_Mm02_00315042 predicted 1377
5 SASI_Mm02_00315043 predicted 1737
6 SASI_Mm02_00315044 predicted 1813
7 SASI_Mm02_00315045 predicted 1623
8 SASI_Mm02_00315046 predicted 1592
9 SASI_Mm02_00315047 predicted 584
10 SASI_Mm02_00315048 predicted 1941
11 SASI_Mm01_00138199 predicted 1346
12 SASI_Mm01_00138201 predicted 656
13 SASI_Mm01_00138203 predicted 539
14 SASI_Mm01_00138204 predicted 884
15 SASI_Mm01_00138205 predicted 1248
16 SASI_Mm01_00138206 predicted 849
17 SASI_Mm01_00138207 predicted 1010
18 SASI_Mm01_00138208 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008967
PTGIR MISSION shRNA Bacterial Glycerol Stock
prostaglandin I2 (prostacyclin) receptor (IP)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-530s1c1
Sequence:CCGGGCCTCTCATGATCCGAGGCTTCTCGAGAAGCCTCGGATCATGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-881s1c1
Sequence:CCGGCTCTGTGGGAATGCCATCCAACTCGAGTTGGATGGCATTCCCACAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-673s1c1
Sequence:CCGGGCCTCAAGTTCTGGTTGTGTTCTCGAGAACACAACCAGAACTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-393s1c1
Sequence:CCGGTGCTGGAATATCACCTACGTTCTCGAGAACGTAGGTGATATTCCAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-599s1c1
Sequence:CCGGCTTCCGCTTCAACGCCTTCAACTCGAGTTGAAGGCGTTGAAGCGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008967.3-1067s21c1
Sequence:CCGGGCACGAGAGGATGAAGTTTACCTCGAGGTAAACTTCATCCTCTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008967
PTGIR MISSION shRNA shRNA Plasmid DNA
prostaglandin I2 (prostacyclin) receptor (IP)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-530s1c1
Sequence:CCGGGCCTCTCATGATCCGAGGCTTCTCGAGAAGCCTCGGATCATGAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-881s1c1
Sequence:CCGGCTCTGTGGGAATGCCATCCAACTCGAGTTGGATGGCATTCCCACAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-673s1c1
Sequence:CCGGGCCTCAAGTTCTGGTTGTGTTCTCGAGAACACAACCAGAACTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-393s1c1
Sequence:CCGGTGCTGGAATATCACCTACGTTCTCGAGAACGTAGGTGATATTCCAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-599s1c1
Sequence:CCGGCTTCCGCTTCAACGCCTTCAACTCGAGTTGAAGGCGTTGAAGCGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008967.3-1067s21c1
Sequence:CCGGGCACGAGAGGATGAAGTTTACCTCGAGGTAAACTTCATCCTCTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008967
PTGIR MISSION shRNA Lentiviral Transduction Particles
prostaglandin I2 (prostacyclin) receptor (IP)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-530s1c1
Sequence:CCGGGCCTCTCATGATCCGAGGCTTCTCGAGAAGCCTCGGATCATGAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-881s1c1
Sequence:CCGGCTCTGTGGGAATGCCATCCAACTCGAGTTGGATGGCATTCCCACAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-673s1c1
Sequence:CCGGGCCTCAAGTTCTGGTTGTGTTCTCGAGAACACAACCAGAACTTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-393s1c1
Sequence:CCGGTGCTGGAATATCACCTACGTTCTCGAGAACGTAGGTGATATTCCAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008967.1-599s1c1
Sequence:CCGGCTTCCGCTTCAACGCCTTCAACTCGAGTTGAAGGCGTTGAAGCGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008967.3-1067s21c1
Sequence:CCGGGCACGAGAGGATGAAGTTTACCTCGAGGTAAACTTCATCCTCTCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000960
PTGIR MISSION shRNA Bacterial Glycerol Stock
prostaglandin I2 (prostacyclin) receptor (IP)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1629s21c1
Sequence:CCGGCTCCAATCTGCGTCCACTTAGCTCGAGCTAAGTGGACGCAGATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-944s1c1
Sequence:CCGGCTTCCGCTTCTACGCCTTCAACTCGAGTTGAAGGCGTAGAAGCGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000960.3-1540s1c1
Sequence:CCGGCCCATCCATCTCATTGTCTAACTCGAGTTAGACAATGAGATGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-734s1c1
Sequence:CCGGCCTCAGCCTCTGCCGCATGTACTCGAGTACATGCGGCAGAGGCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-1221s1c1
Sequence:CCGGGCCGTGGGAACGTCGTCCAAACTCGAGTTTGGACGACGTTCCCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-1259s21c1
Sequence:CCGGCTGCTCCCTCTGCTGACATTTCTCGAGAAATGTCAGCAGAGGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-542s1c1
Sequence:CCGGCTACGCCTTCTGCGTCCTCTTCTCGAGAAGAGGACGCAGAAGGCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-427s21c1
Sequence:CCGGCGTCCATGCTCATCCTCTTTGCTCGAGCAAAGAGGATGAGCATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1448s21c1
Sequence:CCGGAGGGACAGAGGAAACGTTTATCTCGAGATAAACGTTTCCTCTGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000960
PTGIR MISSION shRNA shRNA Plasmid DNA
prostaglandin I2 (prostacyclin) receptor (IP)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1629s21c1
Sequence:CCGGCTCCAATCTGCGTCCACTTAGCTCGAGCTAAGTGGACGCAGATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-944s1c1
Sequence:CCGGCTTCCGCTTCTACGCCTTCAACTCGAGTTGAAGGCGTAGAAGCGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000960.3-1540s1c1
Sequence:CCGGCCCATCCATCTCATTGTCTAACTCGAGTTAGACAATGAGATGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-734s1c1
Sequence:CCGGCCTCAGCCTCTGCCGCATGTACTCGAGTACATGCGGCAGAGGCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-1221s1c1
Sequence:CCGGGCCGTGGGAACGTCGTCCAAACTCGAGTTTGGACGACGTTCCCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-1259s21c1
Sequence:CCGGCTGCTCCCTCTGCTGACATTTCTCGAGAAATGTCAGCAGAGGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-542s1c1
Sequence:CCGGCTACGCCTTCTGCGTCCTCTTCTCGAGAAGAGGACGCAGAAGGCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-427s21c1
Sequence:CCGGCGTCCATGCTCATCCTCTTTGCTCGAGCAAAGAGGATGAGCATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1448s21c1
Sequence:CCGGAGGGACAGAGGAAACGTTTATCTCGAGATAAACGTTTCCTCTGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000960
PTGIR MISSION shRNA Lentiviral Transduction Particles
prostaglandin I2 (prostacyclin) receptor (IP)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1629s21c1
Sequence:CCGGCTCCAATCTGCGTCCACTTAGCTCGAGCTAAGTGGACGCAGATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-944s1c1
Sequence:CCGGCTTCCGCTTCTACGCCTTCAACTCGAGTTGAAGGCGTAGAAGCGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000960.3-1540s1c1
Sequence:CCGGCCCATCCATCTCATTGTCTAACTCGAGTTAGACAATGAGATGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-734s1c1
Sequence:CCGGCCTCAGCCTCTGCCGCATGTACTCGAGTACATGCGGCAGAGGCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-1221s1c1
Sequence:CCGGGCCGTGGGAACGTCGTCCAAACTCGAGTTTGGACGACGTTCCCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-1259s21c1
Sequence:CCGGCTGCTCCCTCTGCTGACATTTCTCGAGAAATGTCAGCAGAGGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000960.3-542s1c1
Sequence:CCGGCTACGCCTTCTGCGTCCTCTTCTCGAGAAGAGGACGCAGAAGGCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000960.3-427s21c1
Sequence:CCGGCGTCCATGCTCATCCTCTTTGCTCGAGCAAAGAGGATGAGCATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000960.3-1448s21c1
Sequence:CCGGAGGGACAGAGGAAACGTTTATCTCGAGATAAACGTTTCCTCTGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)