EMAIL THIS PAGE TO A FRIEND

PTGIS

prostaglandin I2 (prostacyclin) synthase

82 Gene Product Result for
Synonyms: CYP8 CYP8A1 PGIS PTGI
UniProtKB ID: Q16647, Q3MII8, Q9HAX2, Q9HAX3, Q9HAX4
Gene ID:
Human(5740) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
Mouse(19223) prostaglandin I2 (prostacyclin) synthase
Rat(25527) prostaglandin I2 (prostacyclin) synthase
cow(282021) prostaglandin I2 (prostacyclin) synthase
sheep(101116418) prostaglandin I2 (prostacyclin) synthase
Goat(100860894) prostaglandin I2 (prostacyclin) synthase
naked mole-rat(101700601) prostaglandin I2 (prostacyclin) synthase
domestic guinea pig(100734621) prostaglandin I2 (prostacyclin) synthase
Zebrafish(559148) prostaglandin I2 (prostacyclin) synthase
Horse(100071412) prostaglandin I2 (prostacyclin) synthase
domestic cat(101082050) prostaglandin I2 (prostacyclin) synthase
dog(485919) prostaglandin I2 (prostacyclin) synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
P8386 Phenylbutazone human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000961 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000961 Rosetta Predictions human pricing
NM_031557 Rosetta Predictions rat pricing
NM_008968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178855 predicted 1395
2 SASI_Hs01_00178856 predicted 1825
3 SASI_Hs02_00303575 predicted 1387
4 SASI_Hs01_00178857 predicted 1812
5 SASI_Hs01_00178858 predicted 1251
6 SASI_Hs02_00303576 predicted 1838
7 SASI_Hs01_00178859 predicted 1734
8 SASI_Hs01_00178860 predicted 1452
9 SASI_Hs01_00178861 predicted 652
10 SASI_Hs01_00178862 predicted 1800
11 SASI_Hs01_00178863 predicted 1795
12 SASI_Hs01_00178864 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061092 predicted 1346
2 SASI_Rn01_00061093 predicted 1275
3 SASI_Rn01_00061094 predicted 759
4 SASI_Rn01_00061095 predicted 1486
5 SASI_Rn01_00061096 predicted 1406
6 SASI_Rn01_00061097 predicted 1088
7 SASI_Rn01_00061098 predicted 596
8 SASI_Rn01_00061099 predicted 1335
9 SASI_Rn02_00264767 predicted 367
10 SASI_Rn01_00061100 predicted 431
11 SASI_Rn01_00061101 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193001 predicted 644
2 SASI_Mm01_00193002 predicted 1236
3 SASI_Mm01_00193003 predicted 1449
4 SASI_Mm01_00193004 predicted 1135
5 SASI_Mm02_00315049 predicted 1073
6 SASI_Mm01_00193005 predicted 682
7 SASI_Mm01_00193006 predicted 1482
8 SASI_Mm01_00193007 predicted 684
9 SASI_Mm01_00193008 predicted 1284
10 SASI_Mm01_00193010 predicted 410
11 SASI_Mm01_00193009 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000961
VALIDATED
PTGIS MISSION shRNA Bacterial Glycerol Stock
prostaglandin I2 (prostacyclin) synthase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-536s21c1
Sequence:CCGGAGATGGGTCTCCTCGACTTCTCTCGAGAGAAGTCGAGGAGACCCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000961.3-1906s21c1
Sequence:CCGGGTCACCTTCCTAGTTCTTATGCTCGAGCATAAGAACTAGGAAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-1446s21c1
Sequence:CCGGGGAGCTGATCAACGCAGATGTCTCGAGACATCTGCGTTGATCAGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-1393s1c1
Sequence:CCGGGCGGTCAACAGCATCAAACAACTCGAGTTGTTTGATGCTGTTGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-418s1c1
Sequence:CCGGGCCAGGATGAAACTGACTCTTCTCGAGAAGAGTCAGTTTCATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-655s1c1
Sequence:CCGGGCTGATGTCTTCCACACCTTTCTCGAGAAAGGTGTGGAAGACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-234s1c1
Sequence:CCGGGCACGGTGACATCTTTACTATCTCGAGATAGTAAAGATGTCACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-1254s1c1
Sequence:CCGGCCCAGAGGTATTTAAATACAACTCGAGTTGTATTTAAATACCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000961
VALIDATED
PTGIS MISSION shRNA shRNA Plasmid DNA
prostaglandin I2 (prostacyclin) synthase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-536s21c1
Sequence:CCGGAGATGGGTCTCCTCGACTTCTCTCGAGAGAAGTCGAGGAGACCCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000961.3-1906s21c1
Sequence:CCGGGTCACCTTCCTAGTTCTTATGCTCGAGCATAAGAACTAGGAAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-1446s21c1
Sequence:CCGGGGAGCTGATCAACGCAGATGTCTCGAGACATCTGCGTTGATCAGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-1393s1c1
Sequence:CCGGGCGGTCAACAGCATCAAACAACTCGAGTTGTTTGATGCTGTTGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-418s1c1
Sequence:CCGGGCCAGGATGAAACTGACTCTTCTCGAGAAGAGTCAGTTTCATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-655s1c1
Sequence:CCGGGCTGATGTCTTCCACACCTTTCTCGAGAAAGGTGTGGAAGACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-234s1c1
Sequence:CCGGGCACGGTGACATCTTTACTATCTCGAGATAGTAAAGATGTCACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-1254s1c1
Sequence:CCGGCCCAGAGGTATTTAAATACAACTCGAGTTGTATTTAAATACCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000961
VALIDATED
PTGIS MISSION shRNA Lentiviral Transduction Particles
prostaglandin I2 (prostacyclin) synthase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-536s21c1
Sequence:CCGGAGATGGGTCTCCTCGACTTCTCTCGAGAGAAGTCGAGGAGACCCATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000961.3-1906s21c1
Sequence:CCGGGTCACCTTCCTAGTTCTTATGCTCGAGCATAAGAACTAGGAAGGTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000445135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000961.3-1446s21c1
Sequence:CCGGGGAGCTGATCAACGCAGATGTCTCGAGACATCTGCGTTGATCAGCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-1393s1c1
Sequence:CCGGGCGGTCAACAGCATCAAACAACTCGAGTTGTTTGATGCTGTTGACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000961.2-418s1c1
Sequence:CCGGGCCAGGATGAAACTGACTCTTCTCGAGAAGAGTCAGTTTCATCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-655s1c1
Sequence:CCGGGCTGATGTCTTCCACACCTTTCTCGAGAAAGGTGTGGAAGACATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-234s1c1
Sequence:CCGGGCACGGTGACATCTTTACTATCTCGAGATAGTAAAGATGTCACCGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000961.2-1254s1c1
Sequence:CCGGCCCAGAGGTATTTAAATACAACTCGAGTTGTATTTAAATACCTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008968
VALIDATED
PTGIS MISSION shRNA Bacterial Glycerol Stock
prostaglandin I2 (prostacyclin) synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1320s21c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1528s21c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-523s21c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-886s21c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1321s1c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-274s1c1
Sequence:CCGGCAGCTTCCTTACCAGGATGAACTCGAGTTCATCCTGGTAAGGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-524s1c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1529s1c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-887s1c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008968
VALIDATED
PTGIS MISSION shRNA shRNA Plasmid DNA
prostaglandin I2 (prostacyclin) synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1320s21c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1528s21c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-523s21c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-886s21c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1321s1c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-274s1c1
Sequence:CCGGCAGCTTCCTTACCAGGATGAACTCGAGTTCATCCTGGTAAGGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-524s1c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1529s1c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-887s1c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008968
VALIDATED
PTGIS MISSION shRNA Lentiviral Transduction Particles
prostaglandin I2 (prostacyclin) synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1320s21c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-1528s21c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-523s21c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008968.3-886s21c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1321s1c1
Sequence:CCGGGCCTGAGGTGTTTAAATACAACTCGAGTTGTATTTAAACACCTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-274s1c1
Sequence:CCGGCAGCTTCCTTACCAGGATGAACTCGAGTTCATCCTGGTAAGGAAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-524s1c1
Sequence:CCGGGCGCTCACAGAAGCCATGTATCTCGAGATACATGGCTTCTGTGAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-1529s1c1
Sequence:CCGGGACACAGAGGTTCCTGAGTTTCTCGAGAAACTCAGGAACCTCTGTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000067858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008968.2-887s1c1
Sequence:CCGGCTGGAGAGTTATCTGAGACATCTCGAGATGTCTCAGATAACTCTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???