EMAIL THIS PAGE TO A FRIEND

PTGR2

prostaglandin reductase 2

97 Gene Product Result for
Synonyms: PGR2 ZADH1
UniProtKB ID: Q8N8N7, Q3L8A4, Q6MZH8
Gene ID:
Human(145482) Summary: This gene encodes an enzyme involved in the metabolism of prostaglandins. The encoded protein catalyzes the NADPH-dependent conversion of 15-keto-prostaglandin E2 to 15-keto-13,14-dihydro-prostaglandin E2. This protein may also be involved in regulating activation of the peroxisome proliferator-activated receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(77219) prostaglandin reductase 2
Rat(299194) prostaglandin reductase 2
cow(506263) prostaglandin reductase 2
sheep(101105000) prostaglandin reductase 2
naked mole-rat(101708944) prostaglandin reductase 2
domestic guinea pig(100731031) prostaglandin reductase 2
chicken(423244) prostaglandin reductase 2
Horse(100050600) prostaglandin reductase 2
domestic cat(101089020) prostaglandin reductase 2
dog(480383) prostaglandin reductase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035631 MISSION® esiRNA esiRNA human PTGR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152444 Rosetta Predictions human pricing
NM_001015009 Rosetta Predictions rat pricing
NM_029880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218832 predicted 457
2 SASI_Hs01_00218833 predicted 1135
3 SASI_Hs01_00218835 predicted 959
4 SASI_Hs01_00218836 predicted 610
5 SASI_Hs01_00218837 predicted 546
6 SASI_Hs01_00218838 predicted 1010
7 SASI_Hs02_00366202 predicted 638
8 SASI_Hs01_00218840 predicted 712
9 SASI_Hs01_00218841 predicted 346
10 SASI_Hs02_00366203 predicted 1076
11 SASI_Hs01_00218834 predicted 758
12 SASI_Hs01_00218839 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201961 predicted 245
2 SASI_Rn02_00201962 predicted 286
3 SASI_Rn02_00201963 predicted 239
4 SASI_Rn02_00201964 predicted 793
5 SASI_Rn02_00201965 predicted 978
6 SASI_Rn02_00201966 predicted 1105
7 SASI_Rn02_00201967 predicted 1035
8 SASI_Rn02_00201968 predicted 291
9 SASI_Rn02_00201969 predicted 719
10 SASI_Rn02_00201970 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114211 predicted 467
2 SASI_Mm01_00114212 predicted 1355
3 SASI_Mm01_00114213 predicted 309
4 SASI_Mm01_00114214 predicted 1221
5 SASI_Mm01_00114215 predicted 1223
6 SASI_Mm01_00114216 predicted 364
7 SASI_Mm01_00114217 predicted 1344
8 SASI_Mm01_00114218 predicted 710
9 SASI_Mm01_00114219 predicted 1238
10 SASI_Mm01_00114220 predicted 1358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152444
PTGR2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin reductase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-425s21c1
Sequence:CCGGGACACTGGCACTGATTATATACTCGAGTATATAATCAGTGCCAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1410s21c1
Sequence:CCGGATGTGATCATAGGTGTTATTTCTCGAGAAATAACACCTATGATCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-998s21c1
Sequence:CCGGATCATCCTGTGTGGTCAAATTCTCGAGAATTTGACCACACAGGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1442s21c1
Sequence:CCGGGGGTATTTGATACAATCATTACTCGAGTAATGATTGTATCAAATACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1150s1c1
Sequence:CCGGCGGTAATAAATGGGTTGGAAACTCGAGTTTCCAACCCATTTATTACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1216s1c1
Sequence:CCGGGAAAGCAGATAGTTTGCATTTCTCGAGAAATGCAAACTATCTGCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-514s1c1
Sequence:CCGGCCAAGGTTATTCTGGATGGAACTCGAGTTCCATCCAGAATAACCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-270s1c1
Sequence:CCGGCGAATGGAAGAAGTCTATTTACTCGAGTAAATAGACTTCTTCCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152444
PTGR2 MISSION shRNA shRNA Plasmid DNA
prostaglandin reductase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-425s21c1
Sequence:CCGGGACACTGGCACTGATTATATACTCGAGTATATAATCAGTGCCAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1410s21c1
Sequence:CCGGATGTGATCATAGGTGTTATTTCTCGAGAAATAACACCTATGATCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-998s21c1
Sequence:CCGGATCATCCTGTGTGGTCAAATTCTCGAGAATTTGACCACACAGGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1442s21c1
Sequence:CCGGGGGTATTTGATACAATCATTACTCGAGTAATGATTGTATCAAATACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1150s1c1
Sequence:CCGGCGGTAATAAATGGGTTGGAAACTCGAGTTTCCAACCCATTTATTACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1216s1c1
Sequence:CCGGGAAAGCAGATAGTTTGCATTTCTCGAGAAATGCAAACTATCTGCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-514s1c1
Sequence:CCGGCCAAGGTTATTCTGGATGGAACTCGAGTTCCATCCAGAATAACCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-270s1c1
Sequence:CCGGCGAATGGAAGAAGTCTATTTACTCGAGTAAATAGACTTCTTCCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152444
PTGR2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin reductase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-425s21c1
Sequence:CCGGGACACTGGCACTGATTATATACTCGAGTATATAATCAGTGCCAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1410s21c1
Sequence:CCGGATGTGATCATAGGTGTTATTTCTCGAGAAATAACACCTATGATCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152444.2-998s21c1
Sequence:CCGGATCATCCTGTGTGGTCAAATTCTCGAGAATTTGACCACACAGGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152444.2-1442s21c1
Sequence:CCGGGGGTATTTGATACAATCATTACTCGAGTAATGATTGTATCAAATACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1150s1c1
Sequence:CCGGCGGTAATAAATGGGTTGGAAACTCGAGTTTCCAACCCATTTATTACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-1216s1c1
Sequence:CCGGGAAAGCAGATAGTTTGCATTTCTCGAGAAATGCAAACTATCTGCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-514s1c1
Sequence:CCGGCCAAGGTTATTCTGGATGGAACTCGAGTTCCATCCAGAATAACCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152444.1-270s1c1
Sequence:CCGGCGAATGGAAGAAGTCTATTTACTCGAGTAAATAGACTTCTTCCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029880
VALIDATED
PTGR2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin reductase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-617s21c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-943s21c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-654s21c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-1062s21c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-527s1c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-564s1c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-853s1c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-797s1c1
Sequence:CCGGGATGTCTACTTTGACAATGTTCTCGAGAACATTGTCAAAGTAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-972s1c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029880
VALIDATED
PTGR2 MISSION shRNA shRNA Plasmid DNA
prostaglandin reductase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-617s21c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-943s21c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-654s21c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-1062s21c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-527s1c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-564s1c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-853s1c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-797s1c1
Sequence:CCGGGATGTCTACTTTGACAATGTTCTCGAGAACATTGTCAAAGTAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-972s1c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029880
VALIDATED
PTGR2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin reductase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-617s21c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-943s21c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-654s21c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029880.2-1062s21c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-527s1c1
Sequence:CCGGCCTGGCTTGACTTCCTTGATTCTCGAGAATCAAGGAAGTCAAGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-564s1c1
Sequence:CCGGGCCATATATCTGCTGGATCTACTCGAGTAGATCCAGCAGATATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-853s1c1
Sequence:CCGGGAATGAGAACAGCCACATCATCTCGAGATGATGTGGCTGTTCTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-797s1c1
Sequence:CCGGGATGTCTACTTTGACAATGTTCTCGAGAACATTGTCAAAGTAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029880.1-972s1c1
Sequence:CCGGGAGAGAGATTTACGGTATTAACTCGAGTTAATACCGTAAATCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)