PTGS1

prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

377 Gene Product Result for

Synonyms: COX1 COX3 PCOX1 PES-1 PGG/HS PGHS-1 PGHS1 PHS1 PTGHS

Species: Human PTGS1(5742), Mouse Ptgs1(19224), Rat Ptgs1(24693), Zebrafish ptgs1(246226), dog PTGS1(403544), Horse PTGS1(100034087), domestic cat PTGS1(101092557), chicken PTGS1(427752), domestic guinea pig Ptgs1(100714030), naked mole-rat Ptgs1(101698854), cow PTGS1(282022), sheep PTGS1(443551)

UniProtKB ID: P23219, A8K1V7, B4DHQ2, Q15122, Q5T7T6, Q5T7T7, Q5T7T8

Gene ID:

Human(5742) Summary: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. The protein may promote cell proliferation during tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]

Mouse(19224) prostaglandin-endoperoxide synthase 1

Rat(24693) prostaglandin-endoperoxide synthase 1

Zebrafish(246226) prostaglandin-endoperoxide synthase 1

dog(403544) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

Horse(100034087) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

domestic cat(101092557) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

chicken(427752) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

domestic guinea pig(100714030) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

naked mole-rat(101698854) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

cow(282022) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

sheep(443551) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

HPA002834	Anti-Anti-PTGS1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4502490	Anti-COX1 antibody produced in rabbit affinity isolated antibody	human	ELISA, immunohistochemistry, western blot	pricing

SAB2500266	Anti-COX1/PTGS1 antibody produced in goat affinity isolated antibody, buffered aqueous solution	human, mouse	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

MAB5586	Anti-Cyclooxygenase-1 Antibody clone, Chemicon^®, from mouse	bovine, human, mouse, rat	ELISA, western blot	pricing

AV41836	Anti-PTGS1 (AB1) antibody produced in rabbit affinity isolated antibody	bovine, sheep, horse, guinea pig, human, rat, mouse	immunohistochemistry, western blot	pricing

AV41835	Anti-PTGS1 (AB2) antibody produced in rabbit IgG fraction of antiserum	human, mouse	immunohistochemistry, western blot	pricing

SAB1406337	Anti-PTGS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

P7291	Anti-Thromboxane B₂ antibody produced in rabbit whole antiserum, lyophilized powder	human	radioimmunoassay	pricing

C9229	Monoclonal Anti-COX I antibody produced in mouse clone AS70, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

375160	(S)-(+)-Ibuprofen ReagentPlus^®, 99%	human	pricing

CDS021585	[2-Amino-3-(4-bromobenzoyl)phenyl]acetic acid	human	pricing

A7302	4-Acetamidophenol 98%	human	pricing

A3537	5-Aminosalicylic acid ≥99%	human	pricing

A79809	5-Aminosalicylic acid 95%	human	pricing

18858	5-Aminosalicylic acid analytical standard	human	pricing

A1674	Acemetacin analytical standard	human	pricing

Y0000810	Acemetacin European Pharmacopoeia (EP) Reference Standard	human	pricing

PHR1005	Acetaminophen Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

A7085	Acetaminophen BioXtra, ≥99.0%	human	pricing

A5000	Acetaminophen meets USP testing specifications, 98.0-102.0%, powder	human	pricing

A3035	Acetaminophen analytical standard	human	pricing

1003009	Acetaminophen United States Pharmacopeia (USP) Reference Standard	human	pricing

A-064	Acetaminophen solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant^®	human	pricing

A5376	Acetylsalicylic acid ≥99.0%	human	pricing

A3160	Acetylsalicylic acid analytical standard	human	pricing

V900185	Acetylsalicylic acid Vetec^™, reagent grade, ≥99%	human	pricing

A0200000	Acetylsalicylic acid European Pharmacopoeia (EP) Reference Standard	human	pricing

Y0001460	Acetylsalicylic acid for peak identification European Pharmacopoeia (EP) Reference Standard	human	pricing

A5882	Antipyrine analytical standard	human	pricing

10784	Antipyrine tested according to Ph. Eur.	human	pricing

1040005	Antipyrine United States Pharmacopeia (USP) Reference Standard	human	pricing

V900710	Antipyrine Vetec^™, reagent grade, 98%	human	pricing

90567	Antipyrine analytical reference material	human	pricing

A2093	Aspirin meets USP testing specifications	human	pricing

1044006	Aspirin United States Pharmacopeia (USP) Reference Standard	human	pricing

BP617	Aspirin British Pharmacopoeia (BP) Reference Standard	human	pricing

PHR1003	Aspirin (Acetyl Salicylic Acid) Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

B5524	Benzydamine hydrochloride analytical standard	human	pricing

BP610	Benzydamine hydrochloride British Pharmacopoeia (BP) Reference Standard	human	pricing

SML0289	Bromfenac sodium ≥98% (HPLC)	human	pricing

Y0001635	Diclofenac for system suitability European Pharmacopoeia (EP) Reference Standard	human	pricing

1188800	Diclofenac sodium United States Pharmacopeia (USP) Reference Standard	human	pricing

S0765000	Diclofenac sodium European Pharmacopoeia (EP) Reference Standard	human	pricing

BP619	Diclofenac sodium British Pharmacopoeia (BP) Reference Standard	human	pricing

D6899	Diclofenac sodium salt	human	pricing

PHR1144	Diclofenac sodium salt Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

93484	Diclofenac sodium salt analytical standard	human	pricing

39769	Diclofenac sodium salt certified reference material, TraceCERT^®	human	pricing

D3281	Diflunisal analytical standard	human	pricing

1197506	Diflunisal United States Pharmacopeia (USP) Reference Standard	human	pricing

D1750000	Diflunisal European Pharmacopoeia (EP) Reference Standard	human	pricing

D0879	Diisopropylfluorophosphate	human	pricing

38399	Diisopropylfluorophosphate ≥97.0% (GC)	human	pricing

46232	Dipyron monohydrate VETRANAL^®, analytical standard	human	pricing

E0516	Etodolac	human	pricing

PHR1499	Flurbiprofen Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1285750	Flurbiprofen United States Pharmacopeia (USP) Reference Standard	human	pricing

F0285200	Flurbiprofen European Pharmacopoeia (EP) Reference Standard	human	pricing

G6895	Glafenine analytical standard	human	pricing

G7020	Glafenine hydrochloride analytical standard	human	pricing

SML1452	Ibufenac ≥95% (HPLC)	human	pricing

PHR1004	Ibuprofen Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1335508	Ibuprofen United States Pharmacopeia (USP) Reference Standard	human	pricing

I110	Ibuprofen	human	pricing

I0020000	Ibuprofen European Pharmacopoeia (EP) Reference Standard	human	pricing

BP539	Ibuprofen British Pharmacopoeia (BP) Reference Standard	human	pricing

V900344	Ibuprofen Vetec^™, reagent grade, 97%	human	pricing

Y0000881	Ibuprofen for peak identification European Pharmacopoeia (EP) Reference Standard	human	pricing

I1892	Ibuprofen sodium salt analytical standard, ≥98% (GC)	human	pricing

PHR1247	Indomethacin Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1341001	Indomethacin United States Pharmacopeia (USP) Reference Standard	human	pricing

I0200000	Indomethacin European Pharmacopoeia (EP) Reference Standard	human	pricing

I3132	Indoprofen analytical standard	human	pricing

I1762	Isoxicam analytical standard	human	pricing

K1751	Ketoprofen ≥98% (TLC)	human	pricing

PHR1375	Ketoprofen Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1356632	Ketoprofen United States Pharmacopeia (USP) Reference Standard	human	pricing

34016	Ketoprofen VETRANAL^®, analytical standard	human	pricing

K2012	Ketoprofen meets USP testing specifications	human	pricing

BP668	Ketoprofen British Pharmacopoeia (BP) Reference Standard	human	pricing

K2000000	Ketoprofen European Pharmacopoeia (EP) Reference Standard	human	pricing

K1136	Ketorolac tris salt ≥99%, crystalline	human	pricing

Y0000486	Ketorolac trometamol European Pharmacopoeia (EP) Reference Standard	human	pricing

Y0000626	Ketorolac trometamol for peak identification European Pharmacopoeia (EP) Reference Standard	human	pricing

PHR1140	Ketorolac Tromethamine Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1356665	Ketorolac Tromethamine United States Pharmacopeia (USP) Reference Standard	human	pricing

L0664	Loxoprofen solid	human	pricing

CDS014072	lysine acetylsalicylic acid Aldrich^CPR	human	pricing

M4267	Mefenamic acid	human	pricing

92574	Mefenamic acid analytical standard	human	pricing

1379605	Mefenamic acid United States Pharmacopeia (USP) Reference Standard	human	pricing

M0252600	Mefenamic acid European Pharmacopoeia (EP) Reference Standard	human	pricing

PHR1060	Mesalamine Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1392705	Mesalamine United States Pharmacopeia (USP) Reference Standard	human	pricing

Y0000297	Mesalazine European Pharmacopoeia (EP) Reference Standard	human	pricing

BP1075	Mesalazine British Pharmacopoeia (BP) Reference Standard	human	pricing

Y0001574	Mesalazine for system suitability European Pharmacopoeia (EP) Reference Standard	human	pricing

N6142	Nabumetone analytical standard	human	pricing

PHR1040	Naproxen Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

46482	Naproxen VETRANAL^®, analytical standard	human	pricing

1457301	Naproxen United States Pharmacopeia (USP) Reference Standard	human	pricing

BP435	Naproxen British Pharmacopoeia (BP) Reference Standard	human	pricing

N0250000	Naproxen European Pharmacopoeia (EP) Reference Standard	human	pricing

M1275	Naproxen sodium 98.0-102.0%	human	pricing

N5160	Naproxen sodium meets USP testing specifications	human	pricing

PHR1165	Naproxen sodium Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1457403	Naproxen sodium United States Pharmacopeia (USP) Reference Standard	human	pricing

N-042	Naproxen solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant^®	human	pricing

SML0288	Nepafenac ≥98% (HPLC)	human	pricing

N0630	Niflumic acid	human	pricing

N1016	Nimesulide	human	pricing

O9637	Oxaprozin solid	human	pricing

1482207	Oxaprozin United States Pharmacopeia (USP) Reference Standard	human	pricing

P0300000	Paracetamol European Pharmacopoeia (EP) Reference Standard	human	pricing

BP371	Paracetamol British Pharmacopoeia (BP) Reference Standard	human	pricing

Y0001781	Paracetamol for equipment qualification European Pharmacopoeia (EP) Reference Standard	human	pricing

P0800000	Phenazone European Pharmacopoeia (EP) Reference Standard	human	pricing

P8386	Phenylbutazone	human	pricing

1531007	Phenylbutazone United States Pharmacopeia (USP) Reference Standard	human	pricing

79184	Phenylbutazone analytical standard	human	pricing

80184	Phenylbutazone certified reference material, TraceCERT^®	human	pricing

P1200000	Phenylbutazone European Pharmacopoeia (EP) Reference Standard	human	pricing

24-1745	Phenylbutazone SAJ special grade, ≥99.0%	human	pricing

PHR1588	Piroxicam Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

1544508	Piroxicam United States Pharmacopeia (USP) Reference Standard	human	pricing

BP463	Piroxicam British Pharmacopoeia (BP) Reference Standard	human	pricing

P2130000	Piroxicam European Pharmacopoeia (EP) Reference Standard	human	pricing

Y0001475	Piroxicam for system suitability	human	pricing

S2064	SC-560 ≥98% (HPLC)	human	pricing

S0883	Sulfasalazine analytical standard, 98.0-101.5%	human	pricing

1636005	Sulfasalazine United States Pharmacopeia (USP) Reference Standard	human	pricing

BP779	Sulfasalazine British Pharmacopoeia (BP) Reference Standard	human	pricing

S2155000	Sulfasalazine European Pharmacopoeia (EP) Reference Standard	human	pricing

S8139	Sulindac ≥98.0%	human	pricing

1642008	Sulindac United States Pharmacopeia (USP) Reference Standard	human	pricing

S4429	Sulindac meets USP testing specifications	human	pricing

BP1041	Sulindac British Pharmacopoeia (BP) Reference Standard	human	pricing

S2180000	Sulindac European Pharmacopoeia (EP) Reference Standard	human	pricing

SML1495	Suprofen ≥98% (HPLC)	human	pricing

1642507	Suprofen United States Pharmacopeia (USP) Reference Standard	human	pricing

1670502	Tolmetin sodium United States Pharmacopeia (USP) Reference Standard	human	pricing

JN0004	Tolmetin sodium dihydrate ≥98% (HPLC)	human	pricing

471909	(S)-(+)-Ketoprofen 99%	human, mouse	pricing

N5023	Nordihydroguaiaretic acid ≥90% (HPLC), from Larrea divaricata (creosote bush)	human, mouse	pricing

N194	NS-398 ≥98% (HPLC), solid	human, mouse	pricing

I4883	Ibuprofen ≥98% (GC)	human, mouse, rat	pricing

I7905	Ibuprofen meets USP testing specifications	human, mouse, rat	pricing

I7378	Indomethacin 98.5-100.5% (in accordance with BP)	human, mouse, rat	pricing

I8280	Indomethacin meets USP testing specifications	human, mouse, rat	pricing

284785	(S)-(+)-6-Methoxy-α-methyl-2-naphthaleneacetic acid 98%	human, rat	pricing

F8514	Flurbiprofen cyclooxygenase inhibitor	human, rat	pricing

N8280	Naproxen meets USP testing specifications	human, rat	pricing

P5654	Piroxicam ≥98% (TLC)	human, rat	pricing

P0847	Piroxicam meets USP testing specifications	human, rat	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST83040	PrEST Antigen PTGS1 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST23705	SILu^™PrEST PGH1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_000962	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000962	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000962	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_008969	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_008969	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_008969	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU074281	MISSION^® esiRNA targeting human PTGS1	human	pricing

EMU077371	MISSION^® esiRNA targeting mouse Ptgs1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000962	Rosetta Predictions	human	pricing
NM_080591	Rosetta Predictions	human	pricing
NM_017043	Rosetta Predictions	rat	pricing
NM_008969	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000962	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00303577 predicted	2205
2	SASI_Hs01_00136410 predicted	2045
3	SASI_Hs01_00136411 predicted	830
4	SASI_Hs01_00136412 predicted	2153
5	SASI_Hs01_00136413 predicted	2218
6	SASI_Hs01_00136414 predicted	2122
7	SASI_Hs01_00136416 predicted	2196
8	SASI_Hs01_00136417 predicted	2084
9	SASI_Hs01_00136418 predicted	2056
10	SASI_Hs01_00136419 predicted	852
11	SASI_Hs01_00136415 predicted	574

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_080591	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00362320 predicted	2099
2	SASI_Hs01_00140497 predicted	1935
3	SASI_Hs01_00140498 predicted	836
4	SASI_Hs01_00140499 predicted	2039
5	SASI_Hs01_00140500 predicted	2108
6	SASI_Hs01_00140501 predicted	2012
7	SASI_Hs01_00140503 predicted	2086
8	SASI_Hs01_00140504 predicted	1969
9	SASI_Hs01_00140505 predicted	1939
10	SASI_Hs01_00140506 predicted	854
11	SASI_Hs01_00140502 predicted	574

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_017043	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00037628 predicted	1113
2	SASI_Rn01_00037629 predicted	1283
3	SASI_Rn01_00037630 predicted	565
4	SASI_Rn01_00037631 predicted	1243
5	SASI_Rn01_00037632 predicted	1536
6	SASI_Rn01_00037633 predicted	336
7	SASI_Rn01_00037634 predicted	1079
8	SASI_Rn01_00037636 predicted	1193
9	SASI_Rn01_00037637 predicted	222
10	SASI_Rn02_00261229 predicted	1539
11	SASI_Rn01_00037635 predicted	1527

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_008969	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00174971 predicted	1270
2	SASI_Mm02_00315050 predicted	235
3	SASI_Mm01_00174972 predicted	1694
4	SASI_Mm01_00174973 predicted	1625
5	SASI_Mm01_00174974 predicted	1549
6	SASI_Mm01_00174975 predicted	854
7	SASI_Mm01_00174976 predicted	1901
8	SASI_Mm01_00174977 predicted	1453
9	SASI_Mm01_00174978 predicted	1139
10	SASI_Mm01_00174979 predicted	776
11	SASI_Mm01_00174980 predicted	200

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000962 VALIDATED	PTGS1 MISSION shRNA Bacterial Glycerol Stock prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000045523
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-564s1c1
	Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045524
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-1531s1c1
	Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045527
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-1266s1c1
	Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-822s1c1
	Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-225s1c1
	Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229882
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-565s21c1
	Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000962.2-839s21c1
	Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218706
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000962.2-2006s21c1
	Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229885
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-1364s21c1
	Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229883
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-813s21c1
	Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000962 VALIDATED	PTGS1 MISSION shRNA shRNA Plasmid DNA prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000045523
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-564s1c1
	Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000045524
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-1531s1c1
	Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000045527
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-1266s1c1
	Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000045526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-822s1c1
	Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000045525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-225s1c1
	Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229882
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-565s21c1
	Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000962.2-839s21c1
	Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000218706
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000962.2-2006s21c1
	Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229885
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-1364s21c1
	Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229883
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-813s21c1
	Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000962 VALIDATED	PTGS1 MISSION shRNA Lentiviral Transduction Particles prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000045523
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-564s1c1
	Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045524
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-1531s1c1
	Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045527
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-1266s1c1
	Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000962.2-822s1c1
	Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000045525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000962.2-225s1c1
	Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229882
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-565s21c1
	Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_000962.2-839s21c1
	Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218706
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_000962.2-2006s21c1
	Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229885
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-1364s21c1
	Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229883
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000962.2-813s21c1
	Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_008969 VALIDATED	PTGS1 MISSION shRNA Bacterial Glycerol Stock prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000067898
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-1089s1c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067902
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-196s1c1
	Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067899
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-475s1c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067901
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-950s1c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067900
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-1582s1c1
	Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348237
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-2205s21c1
	Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1190s21c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1051s21c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-576s21c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_008969 VALIDATED	PTGS1 MISSION shRNA shRNA Plasmid DNA prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000067898
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-1089s1c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000067902
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-196s1c1
	Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000067899
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-475s1c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000067901
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-950s1c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000067900
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-1582s1c1
	Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000348237
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-2205s21c1
	Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000334227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1190s21c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000334293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1051s21c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000334226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-576s21c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_008969 VALIDATED	PTGS1 MISSION shRNA Lentiviral Transduction Particles prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000067898
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-1089s1c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067902
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-196s1c1
	Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067899
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-475s1c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067901
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008969.1-950s1c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000067900
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008969.1-1582s1c1
	Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348237
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-2205s21c1
	Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1190s21c1
	Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-1051s21c1
	Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008969.3-576s21c1
	Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart