EMAIL THIS PAGE TO A FRIEND

PTGS1

prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

269 Gene Product Result for
Synonyms: COX1 COX3 PCOX1 PES-1 PGG/HS PGHS-1 PGHS1 PHS1 PTGHS
Gene ID:
Human(5742) Summary: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. The protein may promote cell proliferation during tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(19224) prostaglandin-endoperoxide synthase 1
Rat(24693) prostaglandin-endoperoxide synthase 1
Zebrafish(246226) prostaglandin-endoperoxide synthase 1
dog(403544) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Horse(100034087) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
domestic cat(101092557) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
chicken(427752) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
domestic guinea pig(100714030) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
naked mole-rat(101698854) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
cow(282022) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
sheep(443551) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A5376 Acetylsalicylic acid ≥99.0% human pricing
A3160 Acetylsalicylic acid analytical standard human pricing
A6810 Acetylsalicylic acid plant cell culture tested, BioReagent, ≥99.0% human pricing
A2093 Aspirin meets USP testing specifications human pricing
D6899 Diclofenac sodium salt human pricing
D0879 Diisopropylfluorophosphate human pricing
38399 Diisopropylfluorophosphate ≥97.0% (GC) human pricing
E0516 Etodolac human pricing
I1762 Isoxicam analytical standard human pricing
K1751 Ketoprofen ≥98% (TLC) human pricing
K2012 Ketoprofen meets USP testing specifications human pricing
K1136 Ketorolac tris salt ≥99%, crystalline human pricing
L0664 Loxoprofen solid human pricing
N6142 Nabumetone analytical standard human pricing
M1275 Naproxen sodium 98.0-102.0% human pricing
N0630 Niflumic acid human pricing
N1016 Nimesulide human pricing
S2064 SC-560 ≥98% (HPLC) human pricing
471909 (S)-(+)-Ketoprofen 99% human, mouse pricing
N5023 Nordihydroguaiaretic acid ≥90% (HPLC), from Larrea divaricata (creosote bush) human, mouse pricing
N194 NS-398 ≥98% (HPLC), solid human, mouse pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing
284785 (S)-(+)-6-Methoxy-α-methyl-2-naphthaleneacetic acid 98% human, rat pricing
F8514 Flurbiprofen cyclooxygenase inhibitor human, rat pricing
N8280 Naproxen meets USP testing specifications human, rat pricing
P5654 Piroxicam ≥98% (TLC) human, rat pricing
P0847 Piroxicam meets USP testing specifications human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000962 Rosetta Predictions human pricing
NM_080591 Rosetta Predictions human pricing
NM_017043 Rosetta Predictions rat pricing
NM_008969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303577 predicted 2205
2 SASI_Hs01_00136410 predicted 2045
3 SASI_Hs01_00136411 predicted 830
4 SASI_Hs01_00136412 predicted 2153
5 SASI_Hs01_00136413 predicted 2218
6 SASI_Hs01_00136414 predicted 2122
7 SASI_Hs01_00136416 predicted 2196
8 SASI_Hs01_00136417 predicted 2084
9 SASI_Hs01_00136418 predicted 2056
10 SASI_Hs01_00136419 predicted 852
11 SASI_Hs01_00136415 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362320 predicted 2099
2 SASI_Hs01_00140497 predicted 1935
3 SASI_Hs01_00140498 predicted 836
4 SASI_Hs01_00140499 predicted 2039
5 SASI_Hs01_00140500 predicted 2108
6 SASI_Hs01_00140501 predicted 2012
7 SASI_Hs01_00140503 predicted 2086
8 SASI_Hs01_00140504 predicted 1969
9 SASI_Hs01_00140505 predicted 1939
10 SASI_Hs01_00140506 predicted 854
11 SASI_Hs01_00140502 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037628 predicted 1113
2 SASI_Rn01_00037629 predicted 1283
3 SASI_Rn01_00037630 predicted 565
4 SASI_Rn01_00037631 predicted 1243
5 SASI_Rn01_00037632 predicted 1536
6 SASI_Rn01_00037633 predicted 336
7 SASI_Rn01_00037634 predicted 1079
8 SASI_Rn01_00037636 predicted 1193
9 SASI_Rn01_00037637 predicted 222
10 SASI_Rn02_00261229 predicted 1539
11 SASI_Rn01_00037635 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174971 predicted 1270
2 SASI_Mm02_00315050 predicted 235
3 SASI_Mm01_00174972 predicted 1694
4 SASI_Mm01_00174973 predicted 1625
5 SASI_Mm01_00174974 predicted 1549
6 SASI_Mm01_00174975 predicted 854
7 SASI_Mm01_00174976 predicted 1901
8 SASI_Mm01_00174977 predicted 1453
9 SASI_Mm01_00174978 predicted 1139
10 SASI_Mm01_00174979 predicted 776
11 SASI_Mm01_00174980 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000962
VALIDATED
PTGS1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-564s1c1
Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-1531s1c1
Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-1266s1c1
Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-822s1c1
Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-225s1c1
Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-565s21c1
Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000962.2-839s21c1
Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000962.2-2006s21c1
Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-1364s21c1
Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-813s21c1
Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000962
VALIDATED
PTGS1 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-564s1c1
Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-1531s1c1
Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-1266s1c1
Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-822s1c1
Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-225s1c1
Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-565s21c1
Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000962.2-839s21c1
Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000962.2-2006s21c1
Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-1364s21c1
Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-813s21c1
Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000962
VALIDATED
PTGS1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-564s1c1
Sequence:CCGGCGTGAGCTATTACACTCGTATCTCGAGATACGAGTGTAATAGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-1531s1c1
Sequence:CCGGCGCAAGAGGTTTGGCATGAAACTCGAGTTTCATGCCAAACCTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-1266s1c1
Sequence:CCGGCATGGAGTTCAACCATCTCTACTCGAGTAGAGATGGTTGAACTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000962.2-822s1c1
Sequence:CCGGCGGCCACATTTATGGAGACAACTCGAGTTGTCTCCATAAATGTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000962.2-225s1c1
Sequence:CCGGGCCAGTGAATCCCTGTTGTTACTCGAGTAACAACAGGGATTCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-565s21c1
Sequence:CCGGGTGAGCTATTACACTCGTATTCTCGAGAATACGAGTGTAATAGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000962.2-839s21c1
Sequence:CCGGACAATCTGGAGCGTCAGTATCCTCGAGGATACTGACGCTCCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000962.2-2006s21c1
Sequence:GTACCGGGATGGTCTTAAATGCTCATTTCTCGAGAAATGAGCATTTAAGACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-1364s21c1
Sequence:CCGGCCTCCATGTTGGTGGACTATGCTCGAGCATAGTCCACCAACATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000962.2-813s21c1
Sequence:CCGGGGTAGACCTCGGCCACATTTACTCGAGTAAATGTGGCCGAGGTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008969
VALIDATED
PTGS1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-1089s1c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-196s1c1
Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-475s1c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-950s1c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-1582s1c1
Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-2205s21c1
Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1190s21c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1051s21c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-576s21c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008969
VALIDATED
PTGS1 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-1089s1c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-196s1c1
Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-475s1c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-950s1c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-1582s1c1
Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-2205s21c1
Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1190s21c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1051s21c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-576s21c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008969
VALIDATED
PTGS1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-1089s1c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-196s1c1
Sequence:CCGGCTCGACAACTACCAGTGTGATCTCGAGATCACACTGGTAGTTGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-475s1c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008969.1-950s1c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008969.1-1582s1c1
Sequence:CCGGCCCAACTCCATCTTTGGAGAACTCGAGTTCTCCAAAGATGGAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-2205s21c1
Sequence:CCGGGATTTGGAATATAGGCTTAAACTCGAGTTTAAGCCTATATTCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1190s21c1
Sequence:CCGGGCAGCACTTGAGTGGCTATTTCTCGAGAAATAGCCACTCAAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-1051s21c1
Sequence:CCGGCGATCTGGCTTCGTGAACATACTCGAGTATGTTCACGAAGCCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008969.3-576s21c1
Sequence:CCGGGTGAGCTACTATACTCGCATTCTCGAGAATGCGAGTATAGTAGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)