EMAIL THIS PAGE TO A FRIEND

PTGS2

prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)

283 Gene Product Result for
Synonyms: COX-2 COX2 GRIPGHS PGG/HS PGHS-2 PHS-2 hCox-2
UniProtKB ID: P35354, A8K802, Q16876
Gene ID:
Human(5743) Summary: Prostaglandin-endoperoxide synthase (PTGS), also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. This gene encodes the inducible isozyme. It is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. [provided by RefSeq, Feb 2009]
Mouse(19225) prostaglandin-endoperoxide synthase 2
Rat(29527) prostaglandin-endoperoxide synthase 2
cow(282023) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
sheep(443460) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Goat(100860905) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
naked mole-rat(101704771) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Domestic Rabbit(100009248) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
domestic guinea pig(100135607) prostaglandin-endoperoxide synthase 2
chicken(396451) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Horse(791253) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
domestic cat(100126581) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
dog(442942) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5700721 Anti-Cox2 antibody produced in rabbit New rat, mouse, human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4502491 Anti-COX2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200576 Anti-COX2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody Antibody Enhanced Validation human, mouse
immunofluorescence, western blot pricing
HPA001335 Anti-COX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5500087 Anti-COX2 antibody, Rabbit monoclonal clone SP21, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB2500267 Anti-COX2/PTGS2 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, canine, sheep, human, bovine
ELISA, flow cytometry, immunofluorescence, western blot pricing
AB5118 Anti-Cyclooxygenase-2 Antibody clone, Chemicon®, from rabbit bovine, mouse, human, sheep
ELISA, western blot pricing
SAB1406338 Anti-PTGS2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1408624 Anti-PTGS2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
C9354 Monoclonal Anti-COX II antibody produced in mouse clone AS66, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, microarray, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T4376 N-p-Tosyl-L-phenylalanine chloromethyl ketone ≥97% (TLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
375160 (S)-(+)-Ibuprofen ReagentPlus®, 99% human pricing
CDS021585 [2-Amino-3-(4-bromobenzoyl)phenyl]acetic acid human pricing
A7302 4-Acetamidophenol 98% human pricing
A3537 5-Aminosalicylic acid ≥99% human pricing
A79809 5-Aminosalicylic acid 95% human pricing
18858 5-Aminosalicylic acid analytical standard human pricing
A8861 Aceclofenac ≥98% (HPLC) human pricing
Y0001094 Aceclofenac for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
A1674 Acemetacin analytical standard human pricing
Y0000810 Acemetacin European Pharmacopoeia (EP) Reference Standard human pricing
PHR1005 Acetaminophen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
A7085 Acetaminophen BioXtra, ≥99.0% human pricing
A5000 Acetaminophen meets USP testing specifications, 98.0-102.0%, powder human pricing
A3035 Acetaminophen analytical standard human pricing
1003009 Acetaminophen United States Pharmacopeia (USP) Reference Standard human pricing
A-064 Acetaminophen solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
A5376 Acetylsalicylic acid ≥99.0% human pricing
A3160 Acetylsalicylic acid analytical standard human pricing
V900185 Acetylsalicylic acid Vetec, reagent grade, ≥99% human pricing
A0200000 Acetylsalicylic acid European Pharmacopoeia (EP) Reference Standard human pricing
Y0001460 Acetylsalicylic acid for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
A2093 Aspirin meets USP testing specifications human pricing
1044006 Aspirin United States Pharmacopeia (USP) Reference Standard human pricing
BP617 Aspirin British Pharmacopoeia (BP) Reference Standard human pricing
PHR1003 Aspirin (Acetyl Salicylic Acid) Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B5524 Benzydamine hydrochloride analytical standard human pricing
BP610 Benzydamine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
SML0289 Bromfenac sodium ≥98% (HPLC) human pricing
PHR1452 Carprofen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
SML1713 Carprofen ≥97% (HPLC) human pricing
33975 Carprofen VETRANAL®, analytical standard human pricing
1096699 Carprofen United States Pharmacopeia (USP) Reference Standard human pricing
Y0000846 Carprofen European Pharmacopoeia (EP) Reference Standard human pricing
Y0000884 Carprofen for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1683 Celecoxib Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001445 Celecoxib European Pharmacopoeia (EP) Reference Standard human pricing
1098504 Celecoxib United States Pharmacopeia (USP) Reference Standard human pricing
BP1230 Celecoxib British Pharmacopoeia (BP) Reference Standard human pricing
Y0001635 Diclofenac for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1188800 Diclofenac sodium United States Pharmacopeia (USP) Reference Standard human pricing
S0765000 Diclofenac sodium European Pharmacopoeia (EP) Reference Standard human pricing
BP619 Diclofenac sodium British Pharmacopoeia (BP) Reference Standard human pricing
D6899 Diclofenac sodium salt human pricing
PHR1144 Diclofenac sodium salt Pharmaceutical Secondary Standard; Certified Reference Material human pricing
93484 Diclofenac sodium salt analytical standard human pricing
39769 Diclofenac sodium salt certified reference material, TraceCERT® human pricing
D3281 Diflunisal analytical standard human pricing
1197506 Diflunisal United States Pharmacopeia (USP) Reference Standard human pricing
D1750000 Diflunisal European Pharmacopoeia (EP) Reference Standard human pricing
D0879 Diisopropylfluorophosphate human pricing
38399 Diisopropylfluorophosphate ≥97.0% (GC) human pricing
46232 Dipyron monohydrate VETRANAL®, analytical standard human pricing
E0516 Etodolac human pricing
1268706 Etodolac United States Pharmacopeia (USP) Reference Standard human pricing
BP529 Etodolac British Pharmacopoeia (BP) Reference Standard human pricing
E2470000 Etodolac European Pharmacopoeia (EP) Reference Standard human pricing
Y0000768 Etodolac for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
32097 Etoricoxib VETRANAL®, analytical standard human pricing
1268863 Etoricoxib United States Pharmacopeia (USP) Reference Standard human pricing
PHR1499 Flurbiprofen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1285750 Flurbiprofen United States Pharmacopeia (USP) Reference Standard human pricing
F0285200 Flurbiprofen European Pharmacopoeia (EP) Reference Standard human pricing
G6895 Glafenine analytical standard human pricing
G7020 Glafenine hydrochloride analytical standard human pricing
SML1452 Ibufenac ≥95% (HPLC) human pricing
PHR1004 Ibuprofen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1335508 Ibuprofen United States Pharmacopeia (USP) Reference Standard human pricing
I110 Ibuprofen human pricing
I0020000 Ibuprofen European Pharmacopoeia (EP) Reference Standard human pricing
BP539 Ibuprofen British Pharmacopoeia (BP) Reference Standard human pricing
V900344 Ibuprofen Vetec, reagent grade, 97% human pricing
Y0000881 Ibuprofen for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
I1892 Ibuprofen sodium salt analytical standard, ≥98% (GC) human pricing
PHR1247 Indomethacin Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1341001 Indomethacin United States Pharmacopeia (USP) Reference Standard human pricing
I0200000 Indomethacin European Pharmacopoeia (EP) Reference Standard human pricing
I3132 Indoprofen analytical standard human pricing
I1762 Isoxicam analytical standard human pricing
K1751 Ketoprofen ≥98% (TLC) human pricing
PHR1375 Ketoprofen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356632 Ketoprofen United States Pharmacopeia (USP) Reference Standard human pricing
34016 Ketoprofen VETRANAL®, analytical standard human pricing
K2012 Ketoprofen meets USP testing specifications human pricing
BP668 Ketoprofen British Pharmacopoeia (BP) Reference Standard human pricing
K2000000 Ketoprofen European Pharmacopoeia (EP) Reference Standard human pricing
K1136 Ketorolac tris salt ≥99%, crystalline human pricing
Y0000486 Ketorolac trometamol European Pharmacopoeia (EP) Reference Standard human pricing
Y0000626 Ketorolac trometamol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
PHR1140 Ketorolac Tromethamine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1356665 Ketorolac Tromethamine United States Pharmacopeia (USP) Reference Standard human pricing
L0664 Loxoprofen solid human pricing
CDS014072 lysine acetylsalicylic acid AldrichCPR human pricing
M4267 Mefenamic acid human pricing
92574 Mefenamic acid analytical standard human pricing
1379605 Mefenamic acid United States Pharmacopeia (USP) Reference Standard human pricing
M0252600 Mefenamic acid European Pharmacopoeia (EP) Reference Standard human pricing
M3935 Meloxicam sodium salt hydrate ≥98% (HPLC) human pricing
PHR1060 Mesalamine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1392705 Mesalamine United States Pharmacopeia (USP) Reference Standard human pricing
Y0000297 Mesalazine European Pharmacopoeia (EP) Reference Standard human pricing
BP1075 Mesalazine British Pharmacopoeia (BP) Reference Standard human pricing
Y0001574 Mesalazine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
N6142 Nabumetone analytical standard human pricing
1449518 Nabumetone United States Pharmacopeia (USP) Reference Standard human pricing
BP358 Nabumetone British Pharmacopoeia (BP) Reference Standard human pricing
N0020000 Nabumetone European Pharmacopoeia (EP) Reference Standard human pricing
PHR1040 Naproxen Pharmaceutical Secondary Standard; Certified Reference Material human pricing
46482 Naproxen VETRANAL®, analytical standard human pricing
1457301 Naproxen United States Pharmacopeia (USP) Reference Standard human pricing
BP435 Naproxen British Pharmacopoeia (BP) Reference Standard human pricing
N0250000 Naproxen European Pharmacopoeia (EP) Reference Standard human pricing
M1275 Naproxen sodium 98.0-102.0% human pricing
N5160 Naproxen sodium meets USP testing specifications human pricing
PHR1165 Naproxen sodium Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1457403 Naproxen sodium United States Pharmacopeia (USP) Reference Standard human pricing
N-042 Naproxen solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML0288 Nepafenac ≥98% (HPLC) human pricing
N1016 Nimesulide human pricing
O9637 Oxaprozin solid human pricing
1482207 Oxaprozin United States Pharmacopeia (USP) Reference Standard human pricing
P0300000 Paracetamol European Pharmacopoeia (EP) Reference Standard human pricing
BP371 Paracetamol British Pharmacopoeia (BP) Reference Standard human pricing
Y0001781 Paracetamol for equipment qualification European Pharmacopoeia (EP) Reference Standard human pricing
32152 Parecoxib VETRANAL®, analytical standard human pricing
P8386 Phenylbutazone human pricing
1531007 Phenylbutazone United States Pharmacopeia (USP) Reference Standard human pricing
79184 Phenylbutazone analytical standard human pricing
80184 Phenylbutazone certified reference material, TraceCERT® human pricing
P1200000 Phenylbutazone European Pharmacopoeia (EP) Reference Standard human pricing
24-1745 Phenylbutazone SAJ special grade, ≥99.0% human pricing
PHR1588 Piroxicam Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1544508 Piroxicam United States Pharmacopeia (USP) Reference Standard human pricing
BP463 Piroxicam British Pharmacopoeia (BP) Reference Standard human pricing
P2130000 Piroxicam European Pharmacopoeia (EP) Reference Standard human pricing
Y0001475 Piroxicam for system suitability human pricing
S2064 SC-560 ≥98% (HPLC) human pricing
S0883 Sulfasalazine analytical standard, 98.0-101.5% human pricing
1636005 Sulfasalazine United States Pharmacopeia (USP) Reference Standard human pricing
BP779 Sulfasalazine British Pharmacopoeia (BP) Reference Standard human pricing
S2155000 Sulfasalazine European Pharmacopoeia (EP) Reference Standard human pricing
S8139 Sulindac ≥98.0% human pricing
1642008 Sulindac United States Pharmacopeia (USP) Reference Standard human pricing
S4429 Sulindac meets USP testing specifications human pricing
BP1041 Sulindac British Pharmacopoeia (BP) Reference Standard human pricing
S2180000 Sulindac European Pharmacopoeia (EP) Reference Standard human pricing
SML1495 Suprofen ≥98% (HPLC) human pricing
1642507 Suprofen United States Pharmacopeia (USP) Reference Standard human pricing
1670502 Tolmetin sodium United States Pharmacopeia (USP) Reference Standard human pricing
JN0004 Tolmetin sodium dihydrate ≥98% (HPLC) human pricing
T6376 Triamcinolone human pricing
44466 Valdecoxib analytical standard human pricing
PZ0179 Valdecoxib ≥98% (HPLC) human pricing
471909 (S)-(+)-Ketoprofen 99% human, mouse pricing
N5023 Nordihydroguaiaretic acid ≥90% (HPLC), from Larrea divaricata (creosote bush) human, mouse pricing
N194 NS-398 ≥98% (HPLC), solid human, mouse pricing
C80105 Chrysin 97% human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
31375 Dexamethasone tested according to Ph. Eur. human, mouse, rat pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
I7378 Indomethacin 98.5-100.5% (in accordance with BP) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing
284785 (S)-(+)-6-Methoxy-α-methyl-2-naphthaleneacetic acid 98% human, rat pricing
F8514 Flurbiprofen cyclooxygenase inhibitor human, rat pricing
N8280 Naproxen meets USP testing specifications human, rat pricing
P5654 Piroxicam ≥98% (TLC) human, rat pricing
P0847 Piroxicam meets USP testing specifications human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000963 Rosetta Predictions human pricing
NM_017232 Rosetta Predictions rat pricing
NM_011198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152843 predicted 1014
2 SASI_Hs01_00152844 predicted 246
3 SASI_Hs01_00152845 predicted 1217
4 SASI_Hs01_00152847 predicted 1353
5 SASI_Hs01_00152848 predicted 1107
6 SASI_Hs01_00152849 predicted 789
7 SASI_Hs01_00152850 predicted 989
8 SASI_Hs01_00152851 predicted 334
9 SASI_Hs01_00152852 predicted 256
10 SASI_Hs02_00303578 predicted 1142
11 SASI_Hs01_00152846 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261598 predicted 1009
2 SASI_Rn02_00261599 predicted 1334
3 SASI_Rn01_00047564 predicted 1149
4 SASI_Rn01_00047565 predicted 370
5 SASI_Rn01_00047566 predicted 1224
6 SASI_Rn01_00047569 predicted 986
7 SASI_Rn01_00047570 predicted 245
8 SASI_Rn01_00047572 predicted 873
9 SASI_Rn02_00261600 predicted 1544
10 SASI_Rn02_00261601 predicted 1213
11 SASI_Rn01_00047563 predicted 1016
12 SASI_Rn01_00047567 predicted 788
13 SASI_Rn01_00047568 predicted 1138
14 SASI_Rn01_00047571 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320113 predicted 1439
2 SASI_Mm01_00033731 predicted 734
3 SASI_Mm01_00033732 predicted 1647
4 SASI_Mm01_00033733 predicted 1073
5 SASI_Mm01_00033734 predicted 1082
6 SASI_Mm01_00033735 predicted 210
7 SASI_Mm01_00033736 predicted 1647
8 SASI_Mm01_00033737 predicted 1542
9 SASI_Mm01_00033738 predicted 1315
10 SASI_Mm02_00320114 predicted 353
11 SASI_Mm01_00033730 predicted 1440
12 SASI_Mm01_00033739 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000963
VALIDATED
PTGS2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000963
VALIDATED
PTGS2 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000963
VALIDATED
PTGS2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011198
VALIDATED
PTGS2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011198
VALIDATED
PTGS2 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011198
VALIDATED
PTGS2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)